Sex o no sex

Esther Vargas

Soy periodista, blogger, amante de los gatos y escribo todos los miércoles la columna Sobre sexo de Perú.21. En este blog encontrarás algunas confesiones, demasiados consejos y más.

Disfunción eréctil, afrodisiacos, frigidez, penes chiquitos, sexo delivery, escorts, fellatios, condones, poses... Que el sexo no te ruborice, que el sexo no te angustie, que el sexo no te deprima. Que el sexo no te acorrale.

Instrucciones para un fellatio

Compartir:

 

pareja-felacion+copia.jpg

Será cierto que solo una de cada 50 mujeres sabe cómo hacer un fellatio? Chicos, ustedes tienen la palabra...Y chicas, aquí también y como siempre, hay espacio para la defensa.

Hace un tiempo, leí en ADN.es un texto titulado INSTRUCCIONES PARA CHUPAR (BIEN) UN PENE.Era fines de 2008. Pasé el texto a algunos amigos, y todos coincidieron en decir que, efectivamente, a ciertas damas les faltaba 'punche' y bastante amor para esta faena. 

Anoche, un caballero y colega me contó frustrado que estaba harto de la boquita de caramelo de su chica. 

-¿No sabe besar? o ¿Dice muchas veces al día carajo o chesu!!! ?-, pregunté, bastante ingenua, bastante en otra.

Y él me dijo: 
-No, no...Lo que no sabe es chupar..., ya sabes...
-Entiendo, entiendo...-respondí. Y el caballero-colega me pidió escribir un post al respecto. Yo decidí rescatar las brillantes instrucciones de ADN, y aquí las comparto.   

Lo bueno, y con crédito, vale reproducirse. Así que presten atención: 
  

-Para empezar, hay que ponerse de rodillas en el suelo entre las piernas del caballero; además de dar más morbo, esta postura es ideal para dominar toda la entrepierna y poder estimular zonas como el ano o el perineo. También es perfecta si la felación se hace con más de una boca.

-Antes de empezar a chupar, conviene "torturar" un poco al hombre, hacerse de rogar para aumentar el morbo, rozándolo apenas con nariz, lengua o labios, suavemente, mirando a la cara del dueño del falo.

-Una mamada propinada con una lengua seca ni es mamada ni es nada. Asegúrate de que tu lengua está bien húmeda, hidrátala bien: si no se te hace la boca agua, que al menos lo parezca. Si padeces de sequedad bucal, siempre puedes usar un buen lubricante.

-Lame desde la base del pene hasta el glande, primero con la punta de la lengua y luego pasando la sinhueso entera. Humedece bien el falo y luego mastúrbalo con la mano bien empapada en saliva o lubricante.

-Mientras chupas, no dejes las manos tontas, úsalas para acariciar los muslos o estimular el perineo, el ano y los testículos (con las llemas de los dedos y también las uñas, teniendo cuidado de no arañar).

-Sigue lamiendo de abajo a arriba y desde arriba hacia abajo, pero detente en el glande y pon la lengua sobre el orificio de la uretra, estimulándolo bien. Luego recorre todos los bordes del glande con la punta de la lengua, saboreándolo. No olvides demostrar en todo lo momento (mediante gestos lascivos, sonoros jadeos y expresiones guarras) lo mucho que te gusta hacer lo que haces.

-Agarra de nuevo el mango peneal y lame el glande como si fuera un helado. Si ya sale líquido lubricante, absórbelo y extiéndelo por tu lengua sin dejar de mirar fijamente la cara y los ojos del propietario del pene.

-Si vas a poner un condón, ahora es el momento, a ser posible con la boca. Si la pareja es de confianza, es más placentero chupar sin preservativo, pero si no conoces bien a ese hombre ni a su pene, es recomendable usar protección para no contraer enfermedades de transmisión sexual como el Virus del Papiloma Humano que, según un reciente estudio sueco, aumenta considerablemente el riesgo de cáncer de boca.

-Se acabaron las tonterías. Llega la hora de ponerse a "mamar" en serio, tragando el pene entero como hacían los fakires con los sables. Si respiras por la nariz no te ahogarás y, si colocas el cuello de forma adecuada, el pene entrará entero hasta tu garganta caliente. Para las mujeres suele ser más fácil ya que, por regla general, poseen cuerpos más dúctiles y flexibles.

-Quédate un buen rato con el pene dentro de la boca, disfrutando de él, notando cómo crece en tu interior. Puedes hacer "mmmm" para demostrar tu placer y excitar más al dueño del cetro.

-Ahora sácate el pene de la boca y chasquea tu lengua contra el glande. Chúpalo cual pajita. También puedes probar "el toque de la mariposa", es decir, mover ágilmente la punta de la lengua para estimular la zona del frenillo. No dejes que él te fuerce a seguir, ya que eyacularía demasiado pronto. Debes dominar la situación para que el placer dure y el orgasmo sea más intenso.

-Después vuelve a bajar y a subir, estableciendo un ritmo de mete-saca parecido al del coito vaginal o anal, subiendo y bajando la cabeza; él seguro que se acoplará al ritmo con los movimientos de su pelvis. Aquí tu calentón tiene que ser considerable, así que es hora de obedecer al instinto y chupar el pene como si fuera una piruleta, con gula, sorbiendo, babeando, haciendo ruido, tragando. Sin melindres.

-Ano, perineo y testículos son tan importantes para maximizar la erección como el propio pene. Si no te importa y te gusta, lámelos también. Si no, sigue concentrad@ en el pene.

-Si el pene es muy grande o tu boca muy pequeña y tienes problemas para tragar, masturba con la mano mientras chupas: es un viejo truco (muy usado por prostitutas) para que, psicológicamente, parezca que te tragas todo, pero en realidad sólo te comes lo que quieres.

-Si al cabo de un tiempo el hombre no eyacula, esto significa que el pene se ha "acostumbrado" al sube y baja  o a la succión y necesita algo nuevo, así que sácala, agarrra los huevos con una mano y el pene con la otra y míralos bien, con lujuria; luego aprieta la base y, cuando maximices la erección, sigue chupando y lame y relame y retuerce la lengua y traga y haz todos los movimientos que sepas o que tu musculatura lingual soporte. Pasa el tiempo, te cansas y tienes ganas de ver el semen así que es hora de quemar todas las naves.

-El hombre no aguantará mucho más, lo ves en su cara. Llega el  glorioso momento de la eyaculación, donde se medirá el valor de tu trabajo bucal: si todo ha ido bien, un generoso chorro de esperma caliente saldrá de su pene. Así que vete pensando qué demonios vas a hacer con él.

-Si has decidido tragarlo, retrocede un poco para no atragantarte, recibe los chorros en la boca y luego trágalos. Si no, puedes sacarla y dejar que la eyaculación salte sobre tu cara, o bien echártela en el pecho, en el vientre, en los pies o en cualquier otra parte del cuerpo.


Chicas: ¿Saben hacer un fellatio? ¿Qué técnica siguen? ¿La pasan bien o lo hacen por amor?
Chicos: ¿Se sienten bien gratificados con la boquita de sus parejas,novias, amantes o amigas cariñosas? ¿Qué tendrían que hacer ellas para ponerles 20 de nota?
293 comentarios


Ya me dio ganas..
jajaja
Donde esta Maria Curie.
Que escriba..
jajaja

Saludos

Caramba Esther no sabia q existia too un manual de como hacer un felatio.. ahora mismo se lo paso a mi enamorada. No lo hace mal pero por lo expuesto en el texto se ve que puede hacerlo muchisimo mejor. Un 20 a este tema jaja

Estoy bastante de acuerdo con la mayoría de las cosas, aunque debo decir que para un hombre que no permite las estimulaciones anales y sobretoque en esa área, particularmente como sorpresa puede terminar de fregar toda la situación.

Preguntas como "Te gusta?" "Te encanta que te la chupe?" "Te encanta, no?" siempre ayudan a estimular la imaginación del varón.

Lo importante es el ritmo, si no puede seguir porque se cansó, debe conservar el ritmo con la mano, e incluso puede acariciarse el pecho y demostrar excitación de su parte, para que el varón no pierda la fe en la veracidad del asunto.

Para un hombre que sabe que para muchas mujeres dar sexo oral no es agradable, la preocupación por saber o tener en mente que ella está haciendo algo por él aunque a ella no le produzca placer puede fregarle el momento. Es vital que muestre un súper interés en el pene de su pareja, y que nunca lo haga porque se lo piden o se lo ruegan. Una felación sorpresa siempre será la mejor alternativa.

Tampoco hace falta que se vuelva una rutina, mantener el furtivismo de esa experiencia sexual, es absolutamente genial. Y más aún si terminado el proceso él recomensa a la pareja con un cunnilingus recíproco.

Buen post, Esther! Muy rico y útil!
A practicarlo!!!

Yo estoy feliz!

es una lastima que muchas mujeres no les guste hacerlo o que no sepan hacerlo... no he tenido muchas parejas pero todas, si todas solo se quedaron en intentarlo pero no lograron hacerlo bien... les pondria 13... algunas 7 porque solo decian: no me gusta hacerlo.... que les aonsejaria para ponerles 20?? pues enviarles la entrada a tu blog y que lean ese manual... que de solo leerlo ya me imagino alguna de mis ex aplicandolos, o mejor la chica de mi trabajo debajo de su sescritori mientras yo parado vigilo quien viene... eso es seguir pensando en sexo no???
un beso esther
pd como va lo del tono?

Que buenas tecnicas que mencionas,tecnicas que yo tambien aplico jeje,sin considerarme experta a mi hombre le dejo super conforme y feliz de todas las cositas ricas que le hago con mi boquita,me gusta chuparle,lamerle,y tomarme la lechecita,mejor si amanezco antojadisima,quedamos los 2 satisfechos...

La verdad ya me dio ganas también ja!
muy buen post y muy bue manual. Se lo reenviare a mi novia jeje.

Entre el todas las parejas que he tenido solo una sabia como chuparlo. La verdad las otras o yo les tenia que indicar que no muerdan, etc etc .o simplemente lo hacian muy mal.

En ese sentido doy fe que el fellatio es una practica dominada por poquisimas mujeres.

Bien esplícito, y muy interesante.

Saludos!

buen post....con mi pareja(con la cual estamos pasando nuestra peor crisis), me gusta que lo haga pero hasta cierto punto que le digo ya sube...pero jamas he llegado en su boca...no puedo facil puede ser porque ya se que se viene...jamas le indiac has esto o el otro simplemente que haga lo que ella desee...

Saludos desde TM

Es como montar bici! lo aprendes practicando y practicando. Personalmente es mi preferido y siempre la pasamos super. No revelaré mi técnica porque no quiero que se copien...:P

No puedo quejarme. Yo sí tengo suerte. ¡No puedo quejarme!

jaja tomando nota XD

Mi pareja emplea todo lo descrito en esta nota, hasta puedo pensar q le han pedido una opinion a ella. Muy interesante nota.

Esther:
El mejor fellatio que me practicaron fue en Trujillo hace como 10 años, ella no quería perder su virginidad conmigo pero me dijo que tenía unas ganas enormes de chupármela con la condición que le avise al momento de terminar, le dije una de las mentiras mas grandes... "Chupa chupa que yo te aviso" y.... fuaaaa!!! no tuve tiempo, eyaculé en sus labios, su cara y el chisguetazo fué hasta el pelo... no he vuelto a experimentar semejante mamada.

Trujillanazo

No se... aprovechando el fin de semana largo me tire a una mansa paloma de mi universidad... besaba como chiquilla timida, suavecito, despacito, tenia la piel super suave y delicada...

A la hora de entrar al mortal kombat, ps la calateo, la besuqueo, la toqueteo y... No se levantaba el caballero... Uy...

Asi que como se pasaba la hora pucha le di a entender que la chupara... adivinen... no quiso, se corria y se tapo la cara con la almohada...

Pero luego de una hora de habil labor manual, la arrincone y se lo puse en su carita... parece que el jugueteo con los deditos alla abajo la ablando y abrio la boquita y...

No puedo describir lo que paso... era como si hubiese metido al caballero medio alicaido en una humeda habitacion de seda... sus labios apretaban al glande, movia la lenguita debajo... todo despacito, con los ojos cerrados y...

Si, se paro al toque y ya saben lo que hice despues...

Moraleja, la cosa no es concentrarte en tragartela como sea, el asunto es que se concentre en la zona especial y no se haga paltas, que lo mame, no que lo succione como si fuer aspiradora, que lo lama y pase la lengua por los bordes de la cabeza...

Claro que si tiene cara de niña o da unos suspiritos asustadizos... hmmmmm eso vale mas que miles de expresiones "guarras"... al menos a mi se me paro en 10 segundos a tal extremo que si me lo arañaba un gato, se le rompia la garra jajaja.

El caso es que la mayoria de las mujeres no lo sabe hacer, creen que es meterlo a la boca debajo de la lengua y acariciar asi... no pues, o ni siquiera se les ocurre masturbarte mientras te chupan el glande...

Sin necesidad de tragar, puedes masturbar, jalar lo mas que puedas el prepucio y lamer fuerte o succionar suave el glande... van a ver como van a hacer gozar al caballero...

Lamentablemente las chicas que he conocido... un completo cero a la izquierda... creen que con sentarse encima del pata y girar y girar, saltando de arriba para abajo ya el hombre es feliz...

Gracias por el post Esther, como siempre precisa. Ah y esta pendiente el orgasmo masculino desde hace tiempo ah? :)

Pues yo he tenido algo de suerte con las parejas que he tenido los hacian (no todas lo hacian bien) pero si me han tocado expertas en la materia que lo hacian cual actriz porno. ahora que estoy casado mi esposita me sigue deleitando con unas soberanas mamadas las cuales no son muy seguidas, pero cuando lo hace .... es sencillamente increible. Para que una buena mamada lo sea creo que simplemente la mujer lo tiene que disfrutar, si ella lo disfruta y goza al hacerlo (asi se a su primera vez y no sepa hacerlo) pues es seguro que sera de lo mejor para ambos.

La verdad prefiero eyacular con harta leche despues de follar no despues de una mamada como dicen las instrucciones arriba , eso esta bien para la estimulacion.

Por experiencia se que muchas mujeres no la saben mamar , ellas creen que la polla es como un chupete y lo tratan como tal , lo unico que consiguen es la insatisfaccion del hombre porque eso es un importante preambulo para lo que viene despues.

Recuerdo una chica que lo hacia muy bien, labios y boquita humeda parecia haber sido autora de este manual, siempre me hacia terminar en la calentura de su boquita de caramelo..

La enamorada actual, si bien pone su empeño sus dientes hacen doler demasiado y es que la apertura de la boca y saber usar los labios determinan si la experiencia va ser dolorosa o placentera.. las ultimas han sido dolorosas asi que le pongo de nota 08 (solo por el esfuerzo)

Importante.. no solo de fellatio goza el hombre...

Buenos consejos jejejej,mi ex me decia que soy una experta en las mamadas que le hacia, que le encantaba que cuando estabamos juntos le de su mamadita, ahora tengo otra pareja pero parece que no le gusta porque veo como poner sus gestos de cara y no es de placer, cosa contraria con mi ex el si ponia una cara de complesido, ahora mi ex dice que extraña mis mamaditas.

Chicos: ¿Se sienten bien gratificados con la boquita de sus parejas,novias, amantes o amigas cariñosas?
No, las veces que me lo han mamado, han dejado de hacerlo al minuto porque no soportan el olor a requeson de mis huevos.
¿Qué tendrían que hacer ellas para ponerles 20 de nota?
Tendrian que hacerme una mamada tipo pelicula porno.

muy buen post esther!!!!
esta vez si te luciste!!!!
ahora toca:
INSTRUCCIONES PARA UN CUNNILIGUIS!
PLIS!!!!ES MUY NECESARIO!!!

Srta Esther Vargas:
Mi respeto, eres una mujer del siglo 21, felicitaciones y siga ensenando a tantas cucufatas Peruanas, que solamante sabne danar a su hombre.
Humanista
Dr Victor A.endoza

CHICASSS 3 TIPSSS !!!

1.- Siempre miren a los ojos de su hombre
2.- minimo 5 minutos chupandola
3.- Escupe y con la mano la vas secando ..

TIP PLUSSS (Con esa nos enamoramos jaja)

4.- Tomatela y sino pon los senos.

Nada mas.....oh my goodness, Ya se me puso al palo de solo pensar en su boca,

al parecer las chicas tienen mucho que mejorar... seguire esperando leer a marie curie o bebita....por ciertoque tal dificil es hacer el fellatio en las oficinas o en los baños o en cualquier lugar del trabajo,universidad... alguien lo hizo ya??? espero que no solo la adrenalina haya sido placentera...

Me gustaría que nos des también(apoyo a alma mía) cómo hacer un buen cunnilingus tan detallado como el que has hecho con el fellatio(también los chicos necesitamos complacer bien a nuestra chica). Espero que puedas realizar mi pequeño pedido. Aprovecho para decirte lo bueno que es el blog que, aparte de todo placer, es importante porque educa sexualmente.
Saludos, srta. Esther

esther solo quisiera que se me haga un fellatio asi como dice esta parte: También es perfecta si la felación se hace con más de una boca.
solo si se diera ese caso entonces todo lo que esta escrito se me cumpliria. pero como decirle a mi pareja que me gustaria una boca mas espero tu respuesta esther gracias

¿Se sienten bien gratificados con la boquita de sus parejas,novias, amantes o amigas cariñosas?
Lamentablemente las parejas con la que salgo no estan de acuerdo con eso, es muy trabajoso el convencerlas, sabiendo que al final solo será algo de 1 minuto.
¿Qué tendrían que hacer ellas para ponerles 20 de nota?
Mucho, mucho mas...

Buen Post:

De todas las que he tenido, la que mejor me mamó, fue una compañera de trabajo que hacia eso que describes y le gustaba que me venga en su boca, la mitad se lo tomaba y el otro se lo pasaba por toda su cara y pechos, increible

La extraño¡¡¡¡¡

Muchas chicas me han hecho sexo oral, particularmente recuerdo a una que realamente lo hacia muy muy bien, sabìa lo que hacia, creo que leyo esas indicaciones, fueron gratos recuerdos.
Independiente de quien te lo haga, creo que depende tambièn de quien guie el momento, creo que podemos orientar a la pareja para que vaya hacièndolo mejor, pero no niegen tambièn que se siente un cosquilleo cuando sientes sus dientes en el pene jejejeje, a mi me gusta.
Es rico que te lo hagan con yogurt o helado, que te lo unten todo y a lamer se ha dicho, intèntelo lectores, les va a fascinar; bueno algunos imagino lo han hecho asi.



Marie curie, pq no te escribes una de tus historias calentonas...
que todos queremos leer!


Bastante detallado y bueno su manual Esther. Muy didactico! Ojalá muchas chicas lo puedan leer...Gracias
Saludos

Pues muy buenos consejos para que las mujeres que aun no lo saben hacer aprendan estas técnicas.

Muy buenas las clases... ojala las mujeres hallan tomado nota para luego practicar.

Y me uno al pedido de clases para un buen cunilinguis.

Saludos.

Mi esposa lo hace como una estrella porno!
¿Con quiénes aprendió?
¿Cuánta leche se habrá tomado?
No me atrevo a preguntarle...
Me ardería tanto... que moriría...
por combustión espontánea!

Tienen que tener cuidado con el roce de sus dientes y de su paladar duro (la parte alta de su boca), es hueso y duele. Si se concentran en trabajar con sus labios, con su lengua, o lo llevan hacia los costados de su boca todo marcha bien...

Solo 2 de mis parejas lo han hecho espectacular ¿por qué? simple, por que les gustaba, adoraban tener mi pene en su boca, no tenian asco y estaban preparadas para todo, las demás solo me masturbaban con la boca, con miedo a la eyaculación (como si se les fuera a caer los dientes o algo asi), chicas, si quieren hacer deleitar a su hombre disfrutenlo, gozenlo, realmente les tiene que gustar tener el pene de su hombre en los labios, les debe de gustar el sabor del semen, si no les gusta el varón puede comer frutas dulces como plátanos, manzanas, papayas para que sea más dulce ¿no me creen? pues intentelo, que su pareja se coma una ensalada de frutas y ya verán, un consejo gratis.

Añado algo más a lo que dice Jorge:
Por favor, muuucho cuidado si la boca acogedora alberga dientes con brackets (fierritos de ortodoncia) y su dueña no ha leído aún este manual. Auch...

Chicas con "fierritos": tienen alguna experiencia que contar?

By the güey, FELICITACIONES Esther, con este post has cortado oreja y rabo!!!

wowww!estuvieron muy buenos los pasos y sirvieron mucho: para nosotras, pues sigues paso a paso para saber que estas haciendo bien o mal; y para ellos analicen bien a sus parejas y si pueden darle algun otro consejo me parece que seria genial.
con respecto a la pregunta, me encanta practicarle un fellatio a mi novio, lo disfruto, y por lo que simepre veo, el tambien....
esther, tu post es lo maximo! sigue asi que aunq no resido en el peru, todos los miercoles lo leo...
saludos..

Lo cierto es que muchas chicas no saben dar una buena mamada. Muerden y lastiman, otras solo hacen una leve caricia, otras cuando les tocas el tema se sonrojan o se ponen religiosas y dicen q es pecado. Que desastre.

Pocas son las que saben hacer bien esto. Muy pocas y es la verdad.

MONJAS, NADIE LAS QUIERE :D.

Hola a todos en cuanto ami mi experiencia en los fellatio es recien desde el año pasado cuando salia con mi ex (con la cual recien salia un mes antes)y en nuestro primer encuentro intimo comenzamos a desvestirnos y ella me sorprendio cuando me comenzo a besar el pecho y fue bajando hasta mi pene (debo reconocer que tiene unos hermosos labios)y me sorepndi cuando lo empezo a besar y lucio se lo metio a la boca sin mas ni mas lo cual con el gran trabajo que hacia me llevo hasta el otro lado del universo, fue una experiencia inolvidable la cual con las otras parejas que he tenido no se ha repetido (quizas ella lo hizo tan bien que me quede marcado por ese estilo)... ahora que escribo estas lineas ella se me viene a la mente y me han daod ganas de llamarla e invitarla salir, deseenme suerte.... ah y avisenme cuando pongan fecha para la reunion del blog, buen dia para todos....

Esther: te quiero, con los conocimientos y experiencia personal en cuanto a sexo tu eres maestra, contesta a mi correo por favor, quiero probarte y evaluar si eres tan buena en la cama como escribes.-

ojo, no molestarse, si lo haces corro el peligro que me des una mordida mortal en el pene

what?

mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmm Lo máximo Esther! Un excelente post!! Es lo básico para una buena mamada. Chicas algunos tips!!

1. Miren su entrepierna de reojo cuando estan conversando o besándose y él está vestido... Deséen, imaginen, transmitan!!!
2. No vayan de frente a la mamada! Huelan, sientan, giman, pidan, anhelen ;)
3. Ya lo dijeron! Miren a su hombre, como se le hace agua la boca de solo sentir una lengua húmeda y provocativa.
4. Muy importánte, amárrense el cabello! Que se les vea la cara (arrechísima por supuesto) y los labios, la lengua. Ellos nos ven, no lo olviden! Mira a tu hombre tu tb, q sepa cuánto placer te da tenerla en la boca.
5. No sé ustedes, pero a mi me gusta mamarsela a mi hombre... Me excita, me prende, me apasiona, me estimula y mientras más le gusta a él, es lo mejor!
6. Comienza suave por el frenillo y el glande, allí tienen más terminaciones nerviosas y lo sienten más!
7. Un tip importante, de cuando en cuando y mientras el no se percate, chupen la cabeza del pene con un poco de fuerza como absorbiendo, verán q se retuercen de las ganas de tirar...
8. No dejen la mano, acaricien en perineo, los testículos y si pueden lamerlos con la lengua, tendrán a su hombree venirse sin venirse! Sentirán un orgasmo sin eyacular... Alguno ha sentido eso? Mi ex sí!!! Dice q es riquísimo! Bueno hay q hacerlo con mucha práctica.
9. No sé si funcione con todos, pero x ejemplo, yo tengo la boca grande pero al momento de tragarla siento náuseas y como que hipeo. jajajaja eso excita a mi hombre a morir!!! siente q te "atragantas" con su verga...
10. Bueno a algunos les gusta venirse en tu boca, q te la tragues o en tus senos... A mi personalmente me gusta ponerla bieeen dura y luego comenzar una buena faena. Siento q desperdicio si bota en mi boca, con lo q me excita sentirla en otro lugar...

Bueno Esther!!! Buen post!!!!!!!!! Realmente no sé como hay personas q tengan sexo sin un buen fellatio!

Ahora como todos, te pido las instrucciones de un buen cunnlinguis!!!!!!!!!

Gracias

Linda T.

esta buenazo el tema mañana mismo lo practico con mi esposo voy a seguir paso a paso luego les cuento como me fue ¡¡¡¡¡¡¡¡¡¡¡

¿Se sienten bien gratificados con la boquita de sus parejas,novias, amantes o amigas cariñosas?
Sí, cuando sucede está bien.

¿Qué tendrían que hacer ellas para ponerles 20 de nota?
Para yo ponerle 20 primero yo tendría que sacar 20, suelo practicar la equidad, no exijo perfección que no tengo (¿pedidos especiales? sí, quien no los tiene con su pareja)

Pdata: la idea de una sala de chat para interactuar sería buena, nada más habría que filtrar a los menores de edad y a aquellas personas que escudadas en el anonimato se dedican a insultar (un formulario confidencial dirigido por correo electrónico a la blogger, un eficiente seguimiento de la dirección IP y listo, adios "trolls"); ¿fiestas? no gracias, no voy a fiestas o after partys o presentaciones de libros o vernisages o polladas o eventos sociales parecidos, gracias.

Es una chambaza eso de filtrar y todo lo que sugieres, pero necesario
Estoy pensando una noche de chat, solo una noche
Pero necesito tiempo, un poquito de tiempo

Bacán el post Esther
Se agradece

me apunto a esa noche de chat q mencionas, rastreame como quieras no hay problema, avisas ia tienes mi mail

Que rico tema, de tantas hermosas y buenas mujeres que me aceptaron, solo una me chupo tan bien que nunca la olvido, LUISA ERES INCOMPARABLE, que tal fellatio, eres experta, te sigue Carmen, ella lo hace con ganas y mucho amor mas no te iguala, PILAR me muerde por momentos y me hace renegar, SANDRA lo hace con amor, se esmera, se traga todito, se toma el semen, me dijo que no podia vivir sin darle una chuupada a mi pene si embargo no lo hace como LUISA, ayayay Luisita cuanto quiero quele enseñes, le pedí a ella que lo haga como tú sin mencionarte y no puede.-

EStercita, eres tan buena en la cama ? o paraditos?

Luisita me supera
Besos Gerardo

UYYY los FELLATIO, para empezar ami novia no es tanto partìcipe de mamàrmela, pero sì el que Yo se la haga, cuando estoy divirtiendome en su clitoris ella se viene millones de bese creo me empapa los labios una vez salio un chorro indescriptible de orgasmo, claro acompañado de multigritos riquìsimos...

Volviendo al tema, tenìa una ex ya hace mas de 3 años q si ella era la doña mamada, pucha recien abrìa el ojo y estaba alli, me despertaba asì, cuando se quedaba en mi jato era full mamadas mutuas.. pero lo mejor le gustaba y decìa que era dulce mi lechesita...asi que a tomar su quaquer no mas...le daba y le daba...pucha ella si que me exprimìa...

Pero eso si no dejo de pensar que el mejor acto sexual siempre va acompañado de una buena mamada de la mujer que amas...

Uy!
hace 10 años el me enseño su pene, y entre caricias y caricias, y porque yo no queria dejar de ser virgen empezamos con esto de la chupadera, ahi aprendi, pero si confieso que no sabia nada de nada y hacia mil y una barbaridades....el me decia: "no la sabes chupar"
Terminamos..
hace casi 1 año nos encontramos, y pues.. Ahora si lo hice bien, y el hombre temrmino gritando, casi casi segui todos los pasos que mencionaste Esther, pero creo que el asunto es disfrutar y dar disfrute.
Y dice que sigue soñando con mi lengua.. :p

Hola Esther:
Espero que hayas pasado buenas pascuas :).

Respondiendo a tus preguntas...
Saben hacer un fellatio? Si. Que lo comprueben mi ex y mi lindo ex jefe
¿Qué técnica siguen? Toda la listaza que pusiste ya me la sabia(modestia aparte) pues me la paso un amigo de la univ. con quien hablamos mucho de estos temas (no era de ADN, sino de un blog que lo trato de la forma mas cachonda y divertida posible); particularmente me gusta engreir el glande y luego jugar con algo frio o mentolado en mi boca.
¿La pasan bien o lo hacen por amor? Yo no hago algo que no me agrade. Si lo hice fue por que me gusta y, coincidencia! a el tambien jeje

A la chica que lo le guste darse de fellatios, por mas manual que consulte no le va a salir bien porque esto se hace con ganas, para complacencia de ambos.
Saludos

Weno, mi novia no sabia nada de nada, asi que como las "primeras veces" le resultaban muy dolorosas optamos por el sexo oral. Al principio no le vacilaba el asunto, insistía en que era muy grande (aunque yo estoy bien plantado en el promedio) y en general se rehusaba, pero después de que hice mi parte con ella, pues, no le quedó otra que esmerarse, y asi fue mejorando progresivamente hasta que optamos por la pose numérica para estar parches.
Mejoró muchisimo, desgraciadamente nunca se acostumbró al sabor, a pesar de que cuando se dejaba embriagar por la excitación me juraba que le encantaba. Sólo una vez pude terminar en su boca, a pesar de la poca luz que había, su expresión fue lo máximo. Aaaaaaayyyy maldita donde estarás...

-¿Se sienten bien gratificados con la boquita de sus parejas,novias, amantes o amigas cariñosas? La boquita de mi novia..ufff...no me quejo.
-¿Qué tendrían que hacer ellas para ponerles 20 de nota? Poner cara de inocentona, asi da mas ganas (al menos para mi) que si pusiera cara de mamona.

Hola Esther, que lastima que los expertos en la materia, no hayan tenido tu invitacion a "hablar" de su experiencia, estoy hablando de los mejores en la materia osea los hombres que lo practican...y vaya que si lo saben hacer supongo porque conocen mejor que las mujeres la "sensibilidad" masculina.

este tema me hizo recordar a una compañera del trabajo a la que llamamos Nathy Golo-golo, incluso hasta estaba pensando en hacerle un comics con sus historias. Ella en el fellatio hasta le hablaba al pene...jajajajajaja..q risa!...

Hola Esther... Como siempre toda una catedra de sexualidad. Muy buen post. Por favor incluye mi E-mail en caso que hagas un chat. Facil abre una direccion en Hotmail Messenger o crea un grupo en Yahoo.com y listo.
Ah por favor, por favor, postea un "Manual del Perfecto Cunilingus" para equilibrar la in-formacion tan provechosa que brindas.
GRACIAS UNA VEZ MAS!!!!!

No quiero que se escandalicen, hace casi 5 meses salgo con un men, mi primera relación de este tipo (al menos la que a relación llegó), da un toke de roche, ambos nos realizamos sex oral; cuando yo lo hago el man simplemente me dice Wao!!! y yo me averguenzo por que no es algo que haga siempre, pero el problema es cuando él lo hace no siento tan bien como el dice sentirse cuando yo se lo hago... jajaja como anécdota a veces me hace reir... por le llama Querubín a mi fiel e "inseparable amiguito de ahi abajo"... no me censuren por favor.... Libertad de expresión no siento faltar el respeto a nadie...

Saludos Esther y chevere todo.... (C&S)

COMO HACER UN BUEN CUNNILINGUS.

Esthercita, no te estoy quitando la chamba, aqui un avance que grafica algo de lo que yo y mi linda esposa, hacemos periodicamente. Y disfrutamos a lo loco. Algunas veces, previo a este encuentro, nos hemos tomado una o dos botellas de Vino Borgonio Tabernero helado, que aqui en USA, es muy bien apreciado. Ella no es peruana, es blanca, rubia de unos hermosos ojos verdes. Se imaginan a la muneca que tengo en la cama (y gasta la condenada!!!) pero bueno quien por su gusto padece...

Esto no implica el recibir mayores lecciones de una persona tan docta en la materia como usted... Grande Maestra!!!

Aqui un pequeno avance

Con ella tumbada boca arriba y yo entre las piernas, acaricio desde el vientre, pasando por el ombligo, pubis, ingles... Hasta acariciar, amasar ligeramente o estirar de la cara interna de sus muslos, mientras con la boca entreabierta, acaricio los labios.

Pueden ser desde unicamente caricias con la boca casi cerrada, por las ingles y justo por encima de sus labios, en la linea que une ambos, a suaves besos desde la parte mas inferior, subiendo hacia el clitoris, a la vez que se sube de presion e intensidad.

Me gusta mucho ver como por la propia excitacion, se empieza a humedecer toda la zona y al hincharse ligeramente los labios estos se abren solos, que es cuando aprovecho para deslizar las manos desde los muslos hacia arriba, apretando el pubis o a cada lado de las ingles, abriendolo y tensando la piel, pero sin llegar a tocarlo directamente, porque igual que ami me encanta que una felacion sea unicamente con la boca, eso mismo intento hacer yo en un cunilingulis.

Cuando lo he separado un poco, asomo la punta de la lengua, la paso haciendo muchos circulos justo por el agujero y despues, cuando ya he recojido los primeros jugos, subo con ellos por mitad de la rajita hasta dejarlos todos sobre el clitoris.

Desde el clitoris hay muchas posibilidades, creo que hasta que el nivel de excitacion sea demasiado grande y haya que centrarse en lo que cada cual sabe que le encanta a su pareja, lo mejor es jugar y probarlas todas.

Pasando de "pulsar" con la punta de la lengua justo la cabeza del clitoris, a lamerlo muy lentamente como si degustase un caramelo, a darle rapidos lametones pero sin apenas hacer fuerza... Todo vale, segun a ratos se para, se besa alrededor, o se coje con la boca, cubriendo los labios con los dientes, los labios de la vagina y estiro un poco de ellos, hacia arriba o hacia abajo.

Cuando el clitoris empieza a quedarse "tieso" y se nota que esta mucho mas gordo que antes, alterno entre "besos con lengua" desde la entrada del sexo, hasta los mismos sobre el clitoris, apretandolo, o metiendolo en la boca para hacer una fuerte succion, y con el dentro estirar un poco o relamerlo con fuerza desde dentro de la boca.

Para los momentos finales, o incluso antes a modo de "trailer" me encanta separarme ligeramente, buscar los ojos de ella, y sin apartarlos ir abriendo la boca, poco a poco, tanto como pueda, segun vuelvo a pegarme a su sexo y fingir "comermelo" entero, curbriendo con mis labios desde encima de su clitoris hasta abajo del todo. Luego voy cerrando la boca poco a poco, apretando cada vez mas segun succiono, y puedo terminar nuevamente con el clitoris en mi boca, o acabar abajo del todo, metiendo un poco la lengua hacia adentro del agujero, removiendola lentamente.

Y tambien antes de llegar al orgasmo, volver a succionar el clitoris, decidir si meter algun dedo, especialmente curvado hacia arriba, si son dos abriendolos y cerrandolos segun hago un ganchito con ellos en el interior, y hacer una vez vuelva a tener el clitoris apunto de llevarla al orgasmo en mi boca, hacer constantes gestos de succion con la boca, dejando que entre y salga al ritmo al que "bota" por la excitacion, que seguro cada vez va a ser mas y mas rapido, por lo que para cuando vaya a correrse, estare haciendolo justo al ritmo que hace falta.

Todo esto a ella la enloquece, y me dice que los peruanos somos maniosos...jejeje. Tu sabes en la guerra y en el amor todo vale.

Toda generalización es mala pero a riesgo de caer en error emitiré esta opinión.

Todas las chicas menores de 30 años que he conocido tienen un buen "Fellatio" por que tienen mayor información y practica en este rubro. Dentro de las mayores de 30 hay algunas a las que aun hay que enseñarles. Prefiero las menores de 30: se hacen menos problemas y toman el sexo con mayor naturalidad y SIN COMPROMISOS

Aunque lo prefiero como un juego sexual previo al igual que el "Cunilingus"

Supongamos que te encuentras con una inexperta (Cosa imposible hoy en día) estos deben ser los pasos:
1ero. Agarrada del Mazo.- Llevarle la mano lentamente a que coja tu pene y enseñarle el movimiento básico: Mano que se desliza de arriba - abajo siempre desde la cabeza (Algunas se mal acostumbran a sobar del cuello hacia abajo descuidando la cabeza - Glande - que es donde están la mayores terminaciones nerviosas)
2do.- Cogoteo.- Una vez que aprendió la "Agarrada de Mazo" Echados agarrarle desde la Nuca y bajarla suavemente hacia tu pecho, si un no entiende tus intenciones, bajarla hacia la barriga; soltarle la nuca mirarla con gesto de Niño pidiendo un chocolate, ¿No entiendes? pon cara de "Huevón" (Si no entendiste, cara normal nomás)
3ero.- Chupigel juntos.- Una vez que ella lo tenga en su boca, agarra un dedo de ella - Prefiero el índice - y que imite todo lo que tu hagas con su dedo, ella con tu pene. Ahí tienes que poner toda tu inventiva, si no la tienes, te la doy algunas ideas: Lamida alrededor, lamida desde los testículos hacia arriba, succión inclusive también de testículos, hasta la garganta etc.

Una vez que ha aprendido, si le has enseñado bien entonces podrás: Ver la TV, una película, el futbol, leer el periódico, mientras ella hace lo apropiado. ! Ah! como la satisfacción es mutua lo mismo hará ella mientras tu le haces un buen cunilingus.

Clases particulares a partir de Junio -Mi agenda esta saturada- así que amigas tengan paciencia o sigue las instrucciones del manual con tu pareja.

YA VIENE EL CHAT y DESPUES LA FIESTA DEL BLOG ¡Yeah!

hola esther otra vez saludandote desde colombia me agrada la idea del chat me apunto, con respescto al tema del dia, te comento que las parejas que he tenido algunas me hacian llegar al cielo pero otras ni a la puerta de la habitacion, creo que es por falta de experiencia o no les gusta hacerlo y solo lo hacen por complacerlo.
un saludo
y me avisas cuando es el chat
saludos

Tiene algo de cierto esa estadistica, tengo 23 años y he estado con mas de una docena de mujeres, ninguna de ellas sabia chuparla cual actriz de pelicula porno o trabajdora sexual, hasta q llego mi actual pareja, la primera vez q ella me hizo un fellatio fue todo lo q habia imaginado me hizo todas las caricias q yo queria me la chupo, lamio y mordio un poquito era toda una experta hasta termine dentro de su boca, antes solo una chica me habia dejado terminar en su boca pero no le gustaba y lo botaba al cabo de un rato, pero ella es toda una bomba sexy se traga todito mi semen, me dice q es algo amargo pero le gusta y la exita, ademas de todas las poses amatorias q hacemos, un saludo..

Muy buenos días, hasta que por fin llego un tema muy pedido. Mi caso es muy bueno pues tengo mi esposa y me va muy bien con ella, en ocasiones en que he sacado los pies del plato nunca he gozado de una buena mamada pero con mi esposa es distinto, a pesar de que nunca ha tenido nada fuera y conmigo fue su primera vez, la he ido amaestrando en el arte y por complacerme ha aprendido muy bien, cosa que no me pasa con otras y casi siempre ha sido una decepción..... luego continuo

HOLA ESTER: LA VERDAD QUE ME EXCITASTE AL RECORDAR ESOS MOMENTOS CON MI PAREJA, YO AUMENTARIA QUE TAMBIEN LES GUSTAS QUE NOS METAMOS EN LA BOCA SUS TESTICULOS, ESO SI SIN APRETARLOS MUCHO, SOLO UNA LIGERA SUCCION Y DE UNO EN UNO, ESO HACE QUE MUEVAN SUS OJOS COMO SURTIDOR DE GASOLINA JA JA JA

Ester y has tenido experiencia propia o por alguna conocida que halla puesto en practica estos consejos de la mamada perfecta y si han tenido buenos resultados a la primera vez que lo aplicaron...Por lo que he leido me dan ganas de que lo chupen ahora.

Buena voz con lo del chat y sigo esperando la fecha para el tono

Ta que yo si soy piña, a todas mis parejas que he tenido no les ha gustado hacer el fellatio, he tenido que ir donde una trabajadora sexual para saber como se siente, hay alguna esdistica sobre que % de mujeres les guste hacer el fellatio pues a mi me toca las del otro grupo. Saludos

MUY BUENO TU POST ESTHER, SIEMPRE LE DOY UNA MIRADA, PERO ESTE SE PASO, SIMPLEMENTE BUENAZO!!!
LO QUE TE PEDIRIA ES SI HAY ALGUN MANUAL PARA EL CUNILINGUIS, HAZLO SABER PARA AQUELLOS HOMBRES QUE NO SABEN HACER NADA DE NADA.
GRACIAS

Holas, el post es bastante interesante y quiero practicarlo con mi enamorado de la u. Ya varias veces me ha sugerido que se la chupe, pero no se, me da miedo que venga con todo en mi boca. Es decir, vomitare? Me sabra mal? A que sabe exactamente? Hay problemas si me lo trago?

Porfas, contestenme pero con seriedad, nada de gente cochina con insinuaciones!!

Por favor que alguien me alcance papel higienico, con leer nomás ya me vine

Una compañera de trabajo en la oficna me dice Khris, sal con mi sobrina que acaba de llegar de Florida, ella no conoce a nadie, y yo de buena gente acepto. Al verla era una gringuita bellisima de cara, pero de cuerpo estaba un poquito papiadita, pero igual tenia unas señoras teteyras buenisimas, taba cachablee!!, asi que fuimos a comer, a tomar unos traguitos despues la invite a mi casa y se puso a fumar hierva con mi roommate o companero de cuart. Ya cuando taba mariadita, supuestamente la lleve a mi cuarto a ver un videito por mi Pc (teniendo la laptop en la sala) pero igual la flaca acepto, ahi si, de fresaa le saque el troncomovil, ella estaba sentada en la silla de la compu y yo paradoo me miro sorprendidaa y abrio la boquita como queriendoo remojarmeloo, yo me hice el dificilon (jajaja) y se la paseaba por la caratula, la weona n o aguanto y me bajo el lompaa me empujo a la cama y se desvisitoo, me metioo una chupadaaa !!!! pero chupadazaaa!!! Facil cuando me cornetiaba sentia las sabanas de la cama ser succionadas por mi reberendo hogete, esa mamadita fue una de las mejores en m ividaa, despues la weona se tira al suelo y pone en posicion de perrito y me dice fuck me in the ass, queria que se lo meta por el tuboo y yo ni corto ni perezozoo empeceee por la retaguardiaa, des pues la weona medice que no habia tomado pastillas por eso lo queria por ahi, y no por el maruchon. Cuando termine no sfuimosa bañar y dentrode un rato denuevoo empezoo con la faena del chuparon, esta vez hasta la lenguita en el ortoo me metioo y me vinee mas rapido que lo normal, al dia siguiente me llama mi ex y regresamos, nucna mas la volvi a llamar, pero ahorita al leer de esto se me paro la chulapii y toy con unas ganas de verla ala condenada.

QUE HORROR DE TEMA! TE SALVASTE DE NO NACER EN UN PAIS MUSULMAN SINO YA TE HUBIERAN LAPIDADO HACE RATO.....

Te odiooooooooooo, eres mala
por qué Esther?
por qué?

Dímelo si eres valiente, si tienes cara para hacerlo, no te remuerde la conciencia, puedes seguir viviendo tranquila y caminando con la frente en alto y sin sentir verguenza por este acto de lesa humanidad.

Por que no fue este tu primer post?
dimelo mirándome al ojo, dímelo, dímelo
por queeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeé?

una vez en un parque en la victoria, una noche mientras los carros y la gente pasaban ella se arrodillo entre mis piernas me la empezo a chupar .. paraba cuando las luces de un carro pasaban o cuando se acercaba alguien.. tanto tanto que yo me vine en su boca.. ella no se dio cuenta que me venia y cuando empezo a recibirla de un fuerte movimiento se puso de pie a un costado con su rostro de asco y empezo a escupirlo y a quejarse .. para mi fue un cague de risa ver su cara ..
luego conoci a rubi, toda una experta en el tema.. hasta ahora nadie la ha igualado... la ultima vez que estuvimos me pidio que se lo diera por atras, yo me chupe.. entonces como siempre ella me lo chupo y casi casi se traga toda mi leche...

Una mamada hecha por una mujer bonita con carita angelical y tragona, no hay comparación. Es como tocar el cielo. Hagan la prueba y verán. Felizmente tuve esa suerte durante unos años.

Frenillo??? dónde queda???? Esther, por fa, un gráfico

Pensaba que mi flaquita era Magister en el are del GoloGolo, después de leer juntos el tema resultó ser un Chancay de a 20 la pobre, pero bueno; a practicar para alcanzar el ansiado nivel profesional de su espectacular garganta.

Muy bueno el post Esther, de los mejores.

Es cierto que a las chicas en un inicio les cuesta màs aprender este tema, pero cuando lo manejan, pueden dominarnos, totalmente; jajajajaja.

Me apunto, para el chat, el tono, o lo que se haga.

Saludos a todos.

PD: Para ser justo el proximo post, deberia ser del cunnilinguis, para estar a mano.

Diosssssssssss. como me provoco.
No sé si lo haré mal o bien, pero un amigo una vez me dijo "siempre miralo a los ojos y pon cara de arrecha, no sabes lo bueno que es", y desde ahi lo hago. Aunque tengo que reconocer que para mi que la emoción y las ganas que ponga al momento de hacer una felación depende de cuanto me guste la otra persona, por lo general no lo hago mucho. Sin embargo, tengo que reconocer que alguna vez disfrute mucho haciendoselo a alguien, pero en realidad creo que el placer era realmente mio. Es más algunas veces todavía pienso en su falo, claro el dijop que nunca se la habian mamado así, pero creo que se debío mucho a las ganas que le tenía y las ganas de que termine en mi boca. Pero bueno, solo pasó con él, es más casi nunca permitía que terminen en mi boca.
ayyyyyyyy como te extraño.

Yo no me puedo quejar...mi enamorada era primeriza, pero desde el dia 1 demostro un talento innato que solo me queda agradecerele de corazon. Que buenos mameys me metia!! en su casa, en la mia, en la universidad, en el auto, etc...jajaja...buenas epocas!

buen tema felicitaciones esther siempre leo tu blog y es muy interesante... sigue asi.

Que tema caliente y provocador, muy didáctico para mi particularmente porque enseña algunos tips que nunca esta demás aprender. Tendré que ponerla en práctica. Lo que no entiendo de mi actual pareja es cuando tengo su miembro en mi boca, él se esmera sujetarme la cabeza y metermela mas de la garganta a tal punto de provocarme nauseas y ganas de vomitar. Quien me puede explicar eso, porque ese gusto.

auch que aburrido eres LUISMI, así no le haces cosquillas a nadie, esa marie curie igual, incipientes novelistas

PARA LORENA:una vez que tengas muy al fondo de tu garganta sentiras arcadas, mas no te preocupes con la práctica constante gozarás cuando lo sientas en la tráquea-

Me encanta cuando mi amiguita y mi esposa hacen la lengua del mismo tipo de los bebes, viste como toman su lechita, pon igual la lengua, es incomparable sentir esa mamada

Hola Esther.

Me encanto el post. Es gusto lo q necesitaba para animarme hacer el fellatio. La verdad es que nunca me anime xq me daba y reconozco q ahorita al leer con solo imaginarme me dio asco. Reconozco q soy muy asquienta en todo sentido. Sobretodo cuando yo tengo q hacer el sexo oral. Cuando el me lo hace no tengo asco. No se como superarlo. Por ahora estoy sin pareja pero muy pronto estare con una y cuando tengamos vida sexual si me gustaria corresponderle como se merece y hacer todo lo qeu esta explicado. ¿Còmo puedo superar ese asco? Espero algun consejo.

bien con el tema Estersita ahora que mi esposa lo ponga en practica ya que es incipiente en estos menesteres aunque veo q poco a poco esta aprendiendo............ahhhhhhhhhcomo extraño tu lengua V'

LOLA:

se dice "COMO LOS OJOS DE CARNERO DEGOLLADO"

PARA ELI (16 de Abril) mis ex y ahora novia gozan cuando le doy en la boca, se toman hasta la ultima gotita saboreandola, ellas pensaban igual que tu, sentían recelo y hasta asco, en el momento de su mayor excitación de tanto chuparmela sentían que eyaculaba en la boca y ella no se movio con la intención de sacarla, continuaban hasta darle cuenta a la ultima gota, ahora me piden les eyacule en la boca, en la cara (dicen que es bueno para el cutis por la buena cantidad de vitamina E) entonces Eli, adelante, prueba y olvidate del asco, llegado el momento tú misma sin que te controles pedirás te eyacule en la boca

Lo mismo ocurre con la eyaculación femenina, cuando hago la sopita me encanta que mi mujer eyacule en mi boca, siento ese sabroso líquido en la lengua y empiezo a lamerselo todo, me parece que regenera las células de la cara tanta tomada del liquido seminal de la mujer, a mi edad me siento y me ve la gente mucho mas joven que otros de mi edad

PROVECHO Y A GOZAR

¿Sexo a los 13 años no es pedofilia? (erróneamente, algunas personas imbuidas de machismo, hombres y mujeres, consideran que cuando la víctima es varón no existe delito), los textos que difunden con normalidad prácticas sexuales con menores de edad estan haciendo apología del delito, favor consultar con el abogado de Peru21 y luego proceder (texto: Luis Mi: el 16 de Abril 2009 a las 7:32 PM. Gracias.

PARA LORENA bueno, auqello que comentas es muy común en la pelis porno. Por lo general la mayoría de los hombres fantasean con "follar" a una mujer por la boca. Es por ello que tu novio hace aquello. ¿Recomendación? Pues simple y llanamente dile que no te causa gracia aquello. A no ser que lo haga. Además el hecho de que te llegue a provocar arcadas, como que... no es muy excitante, ¿verdad? Un saludo,y muy buen tema Esther.

Excelente articulo
quizás para agregar... sería alucinante ver que la doncella que hará la mencionada faena esté de rodillas como en cuatro... con la cola bien parada... ver esas curvas son excitantes..

AHORA DE CULTURA GENERAL UN ARTICULO DIRIGIDO A LOS HOMBRES PARA QUE HAGAN UN BUEN FELLATIO A LAS MUJERES.

Gracias

Excelente tema,
Incluso me parece haber compartido experiencias en ese sentido en anteriores temaas. Soy partidario y me agrada que me la mamen, en general no e tenido problemas con mis parejas, pero hubo una que creo sabia todos los tips que mencionaste; y, además era muy creativa (como besarme los testiculos y de tanto en tanto decir lo mucho que le gustaba mi Verga).
Una noche de sexo sin coito, me regaló dos mamadas espectaculares, hasta llegar al clímax (eyaculación), no pidió mas que eso, era realmente felíz en el asunto; por supuesto, yo ni hablar.
Como los demas seria bueno nos digas cuando es el chateo que me apunto... ah, y felicito a Linda por su sinceridad al tratar el tema.

de verdad que hay de todo...flacas que los chupan bien rico metiendose todo a la boca..algunas lo saben apretar bien...otras juegan rico con el glande...otras lo hacen buen rato sin respirar,,,,cuando hay amor,siento que no importa como lo haga, igual es maravilloso,,,,pero si quieren sacarse en el clavo, en las cucardas las colombianas o ecuatorianas lo hacen de maravilla, mucho mejor que nuestras queridas charapas.

HOla Esteher, me encanta la forma en que dices las cosas, súper directa, genial!

Esther, asi pones arrecho a cualquiera, va mi primer pajazo del dia.

Te todas las flacas que me hicieron fellatio, solo recuerdo a una, Betty, mamaba como las diosas, me podia dar un 3 al hilo, era buenísima, ahora esta con un patin medio corcho no creo merezca las mamadas.

Un secretito: tomar vino y comer frutas, le da sabor a tuti fruti la leche, asi se hacen adictas al mameluco.

Betisita, por una mamadita mas, no importa te sería fiel por 24 horas mas.

Y Esther, que sabor prefieres, tutifruti o natural.

Tambien he tenido de las lonlas que me rozaron con sus dientes de conejo, que casi se asfixian con el torrente, aquellas que luego de un beso en la mejilla defrente se van al cabezón, pero ninguna como Bety. 'tamare como la deje ir...,

para fiorela si al hacer el fellatio te da asco puedes hacer un juego con tu pareja comensar con los ojos vendados y untar el pene de tu pareja con chocolate o con otra cosa que te guste asi conseguiras que no te dee asco

Para FIORELLA, facil ponle leche condensada, mermelada, fudge, ese tipo de cosas para q le agarres el gusto y ya luego a peluche con furia!

los tips estan muy buenos, felicitaciones esther. pero tengo q sacar la cara por los hombres gays, la verdad q los amantes q tuve, todos quedaron satisfechos y sin leer el manual; y de las chicas con las q estuve, sólo 2 supieron hacerlo (hasta el consumo final).

REcuerdo que unas me la chupaban y podia pasarme varios minutos viendo como me lo hacian pero no me exitaban , no seguian estas tecnicas creo, pero yo las dejaba no mas... una vez una amiga me la quiso chupar en un taxi pero no le deje, despues de leerte creo que lo hare, ERES UNAS INSPIRACION ESTHER :)

Hola Esther,
Sinceramente las mujeres en general se intimidan para hacer un fellatio, si bien acceden a hacerlo no lo hacen bien, a mi ultima expareja le pondria un 10 jalada totalmente, quiza por eso no seguimos jeje. Lo que yo hago para que ella acepte hacermelo primero yo doy la iniciativa, la beso apasionadamente sus partes intimas, ppalmente sus labios de abajo -particularmente me encanta hacerlo- y luego cuando queda bastante excitada, acceden a devolverme el favor, pero como te indico, no lo suelen hacerlo bien, tampoco tienen que ser como una estrella porno, simplemente deben esforzarse un poco mas. Asi como das consejos para las mujeres hacer un fellatio.. habra unos tips para los hombres de como hacerselos a las mujeres??.
Thanks

Bueno, q puedo decir mi actual pareja es pesima, no le gsta para nada, me la hizo un par de veces pero no me dejo ni 1/2 satisfecho, muy a pesar q yo la hago llegar a gritos con un buen oral.
Cosa q no pasa con mi anterior pareja, ella si sabe hacerlo muy, pero muy bien, a ella le pondria la mas alta nota.
Bueno el tema!!!.

Ya se eliminó el comentario
Gracias

Gracias Esther
inmediatamente se lo paso a mi profe de ingles ... ojala pueda superar a la que hace mi esposa...

Esther:
Ayer en la noche te revie una extensa historia relacionada con el tema pero no la veo publicada ¿Te llegó mi correo?

No la podemos publicar porque podría parecer apología a la pedofilia. Te mandé un mail.

buen post,pero yo ya sabia todo eso:
miquita cuando quieras te enseño donde esta el frenillo, es mas te dejare tocarlos y lamerlo.
fiorella debes haber enamorados bien cochinos. la mia es suave dura y de sabor neutro, mi semen sabe dulce, por eso es que esta verga ha entrado a taaaaaaaaaaaaaaaaaaaaaaaanta cavidad bucal (dulce pero no provocs caries). mi correo es: sementalcasado@hotmail.com

No lo recibi, pero ok. Hare algunas correcciones para superar ese tema.

Simplemente aplaudo la mosión de información y saludo a todas aquellas damas que lo hacen con sentimiento y dedicación, no es solo chuparla, es entregarse a la mamada con más que la boca. En efecto, el cunilinguis podría ser un tema a seguir, digo siempre es bueno aprender algo más.

mmmmm cada comentario me pone a mil... con unas ganas de salir y que una buena hembra ( prosti) que si la saben hacer recupere el tiempo perdido a mi y ami amiguito.... que paso con marie curie???? estara con las manos ocupadas???? o no le gusta el tema??? ojala pueda leer pronto algo de ella....chicas solo hagan caso a los consejos de los demas....y veran lo que bien que la pasan y nos hacen pasar a nosotros ya que luego satisfechos les haremos gozar mas que antes......buena voz con lo del chat en la noche...creo que es mucha chamba eso del IP, creo que somos adultos como para comportarnos como adolecesntes...espero pronto noticias sobre el chat o del tono..saludos esther....

Una vez caímos en el ring con una chica de esas cuasi inocentes y muy novata, era su primera vez (según ella) que hacia un cunnilinguis… su inexperiencia se transformo en desesperación, ya no lo chupaba, se lo tragaba, se atragantaba, lo sacaba recobraba aires y seguía engulléndoselo hasta los testículos mientras los ojos se le ponían blancos y me alocaba con unos gemidos ahogados, el desastre fue cuando me vine… (cuantos mililitros pueden salir en una buena eyaculacion???) ella se atoro, le falto el aire y vomito toda la pizza hawaiana que se había empujado… !!
Ay pequeña… donde andarás…

Estas hilarantes palabritas son de uso muy común por estos lares:
Mamada
Golo golo
Chupigel
Chulapi
weona
mamey
teteras
mameluco
tubería
mama ocllo
pajazo
tubo
Estamos destruyendo el idioma de Cervantes?... si, destruyámoslo!!!! :)

A Karla me gustaría empalarla por cada uno de sus orificios corporales… por cucufata y extremista

Esthercita, Después de las respectivas instrucciones del cunniliguis, que ya nos debes, estaremos preparados para unos 69 de antología.

Ya es hora también que escribas sobre el vouyerismo… el que no es sapo que tire la primera piedra!!!

Esther querida en la reunión pondremos en practica los conocimientos adquiridos?
Tomaras examen????? :)

Que tal Esther, muy interesante el post para que las feminas perfeccionen su desempeño en el sexo oral, particularmente no me puedo quejar con mi actual pareja, ambos disfrutamos a plenitud del sexo oral, y de hacer el amor en general. Cuando recien empezamos no habia ascensor donde no me lo chupaba, eran mamadas cortas pero muy excitantes, asi como en los taxis, buses cuando ibamos a Trujillo, oficina cuando a veces me vistaba en fin, ahora ultimo hasta en un mototaxi lo hizo que exitante es realmente. Por otra parte es curioso pero desde hace algunos meses, le esta gustando demasiado el sexo oral que le practico, que es mas el tiempo en que le practico el sexo oral que el que la penetro, ella me dice que siga que siga que por favor no deje de hacerlo, suele llegar en mi boca y a mi me gusta, no se si este bien pero me encanta como huele su vagina, es un olor agradable tanto asi que en medio de mi excitación ya son varias las veces en que he metido mi nariz e inhalado como quien fuma, puede parecer gracioso pero eso la transforma, la aloca, y bueno pues yo me tomo todos sus jugos vaginales. Espero poder participar del chat, saludos a todos y felicitaciones por el Blog Esther!!!

HOLA...LA VERDAD NOSE COMO EMPEZAR A DECIR ESTO O HACER ESTE COMENTARIO LA VERDAD ES QUE CUALQUIERA QUE ME VE PUEDE DECIR QUE SOY TODA UNA SEÑORA PERO DE LO QUE MAS ME SIENTO ORGULLOSA ES DE SENTIRME UNA PUTA Y VERDADERA PERRA EN LA CAMA Y ES QUE EL FELLIATO O COMO VULGARMENTE SE LO PIDO A MI PAPI ME DEJAS DARTE UNA BUENA MAMADA ES LO QUE MAS ME EXITA Y CUANDO MI ESPOSO SE LA SACA Y ESTA TODO DURO ES COMO MI INSTINTO ANIMAL SALE Y EMPIEZO A MAMARSELA Y POR LAS MAÑANAS DESPERTARLO MAMANDOSELA Y EL DICE PORQUE SERAS TAN KACHERA. Y YO ENCUENTRO EL 75% DE MI ORGASMO EN MAMARSELA A MI MARIDO POR QUE ME EXITO TODITA Y YA STOY LISTA PARA UN BUEN COITO Y ES QUE ME MOJO QUE PAREZCO CAÑO Y MAMARLE LOS HUEVOS Y ACARICIAR TODO ALREDEDOR DEL PENE ES UNA SENSACION RICAA DELICIOSA MORDER LA CABEZITA ESO SI QUE ES RICOOOOOOOOOOO

hola esther muy bueno tu blog y el tema es normal y ya dejo de ser tabu...........
y bueno leo mucho suqe dicen que la mujer asi que la mujer asa que no sabe o que no lo saben hacer
bueno no se si eh tenido pocas o muchas mujeres la verdad que nunca me fije
en eso
pero toda mujer tiene un estilo en especial
ahora bien creo que la mujer lo va hacer siempre y cuando uno como hombre sepa como tratarla y bueno la mujer es asi
y creo que lo maximo es tener la una buena mujer, buena hembra y buena amante en una sola mujer.
Una vez mas te felicito esther por tu blog y esperando nuevos temas como...........
Has hecho el amor con la Dueña de un Blogggg???????? jajajjaja mentira
chau

LAS FLACAS MUCHAS VECES SE HACEN LAS TERCIAS PARA FELLATIAR!
PERO COMO LES ENCANTA LA LENGUITA!!!
SI QUE SI!

Esther, como es eso de mas de una boca, te refieres a dos o mas personas.................................................................¿También es perfecta si la felación se hace con más de una boca?.

Hola Wape
A tu pregunta respondo: No, lamentablemente

Esther. Tu crees q es recomendable comenzar a tener sexo oral en la ducha,`serà mas exitante. Gracias q los que me han aconsejado como quitarme el asco al momento en el q yo tengo q realizar un fellatio, espero mas comentarios. Besos!

Hola Esther..........

Que tal tema, Esther te luciste con este post,
De solo leerlo se pone la pinga mas dura.... mela ya me vine, es que de imaginar todas estas situacione que relatan;

Recuerdo que tuve a una hermosa bebe con carita angelica de piel blanquita toda una beba...jajaja, porque eso era una beba ya que le gustaba chuparme la pinga en todo momento y situación;
Nada se compara el ver esa dulce carita arrecha con una ganas locas de chupar, lamer y tomar toda su lechecita, porque principalmente eso le gustaba, que me venga en su boca, pucha la flaca me dejaba la pinga mas seca me sacaba hasta la ultima gota de semen, esa beba....

Por lo que veo hay muchas bebas por estos lares... JAJAJA.
Y donde esta el relato hot de mi amor platonica (Marie Curie), lo estoy esperando con unas ganas.

Saludos.

Buen tema Esther ,personalmente me encanta hacerlo, claro esta con mucho amor,hago todas las tecnicas habidas y por haber,porsiaca ya anote todo,sabes hacerlo,me dijo mas de uno,asi asumo q se hacerlo,pero uno nunca deja de aprender.
Me agrada la idea del chat,pero hablar de sexo de buena onda con educación ,sin perversiones,violadores, pedofilos y demas enfermos…

algo que tambien es bien rico es cuando ella me muerde despasito el escroto o mete uno por uno mis huevos en su boca . claro si jalarlos por que duele como no se imaginan bueno eso es algo extremo pera a quien no le gusta la adrenalina.

la cajera de esta cabina desde donde les escribo tiene una bocasa que me imagino debe hacer maravillas .
me muero de ganas de que me la chupe.

cuidense chau.

Muy buen post, y las instrucciones son las correctas, yo me considero un buen mamador, los hombres gay sabemos hacerlo muchoooo mejor que las mujeres, los tips son los correctos, siempre hay que mirar a tu pareja, hacerle sentir que tu lo sirves, que te domina, tocar los testiculos y lamerlos, los mismo el pene, jugar con el frenillo, con la uretra y tratar de tragarlo todo, en el momento de la eyaculacion recomiendo que, o continuen chupando y reciban toda la leche en la boca y luego bueno si quieren la tragan o la botan o, antes de la eyaculacion saquen el pene de la boca y abran la boca bien, saquen toda la lengua y esten siempre dispuestas a recibir el chorro. Se que es dificil tragar semen, pero tiene su gustillo, si te gusta tu pareja pues lo vas a disfrutar, yo deseaba tanto algunos hombres que feliz de comermelo todo, solo por la sensacion de que los tengo completamente.

a Lena... pasa la dire d es blog q mencionas

Creo que agregaría un tip, tener cuidado con los dientes, que no vayan a lastimar el miembro.

Querida Esther: Mil disculpas por el error involuntario anterior; alli va la historia motivada por el tema de hoy, tu blog y los relatos de Mari Curie que contagian a cualquiera.

Alejandra (en medio de una conversación animada, pues ambos vivíamos juntos en una pensión) me pregunto… ¿Ya haz tenido intimidad con alguien? (Nos habíamos conocido hacía unos días al llegar yo de vacaciones luego de un cansado semestre en la universidad)
Yo dude un poco pues no quería decirle que aun no las había tenido, pero luego de unos segundos me decidí a decírsela.
Ella entonces (sin demostrar su sorpresa para no hacerme sentir mal) me contestó….no importa… ya tendrás tiempo para ello.
La pregunta si bien es cierto me había causado cierta vergüenza (y por su puesto mi respuesta más aún pues había admitido abiertamente que a mis 19 años en ese entonces, no había tenido nada de nada), me había causado igualmente una gran inquietud y esa noche excitado como estaba no pude dejar de masturbarme pensando en la preciosa Alejandra.
Dos noches después y cuando ya estaba dispuesto a descansar, escuche que ella (que ya frisaba aproximadamente los 30 años), me llamaba asustada desde la ventana de su dormitorio, por lo que acudí de inmediato.
Al llegar me dijo que estaba asustada pues había escuchado ruidos por la ventana que daba a un jardín exterior; no me quedo más que revisar por si había alguien pero al no encontrar nada le pedí que se calmara. Ante esto ella me solicito quedarme un momento para conversar y esperar a ver si nada pasaba. Así lo hice y empezamos a hablar de varios temas personales.
Ella volvió a tocar el tema de mis relaciones intimas con alguien y yo le conteste lo mismo que en oportunidad anterior, agregando que dada la edad que ya tenía me gustaría tener sexo con alguien, pero que no había encontrado la oportunidad de hacerlo. La mire directamente a los ojos y descubrí que ella me estaba mirando también, por lo que perturbada giro rápidamente la cara dejando de hacerlo.
En ese momento me sentí realmente excitado y rápidamente pensé como entrar más directamente en el tema y ver que pasaba.
Le pregunte entonces directamente:
- Alejandra, no he tenido sexo aun pero me gustaría saber algo más directamente relacionado con el tema, por que como comprenderás no es cómodo para alguien de 19 años………
- ¿Que te gustaría saber exactamente?, me dijo...
Pues como es que se hace el amor le respondí..
-Ella que además me había tomado mucho cariño me dijo….. bueno tratare de explicarte de la mejor manera para que cuando llegue el momento estés preparado. Lo curioso es que me hablaba sin mirarme directamente en evidente muestra de estar nerviosa igualmente.
- Bueno Alejandra, entonces estoy atento a saber algo mas sobre eso, le dije.
-Ella me contestó, entonces obviaremos las partes de cada cual pues seguramente eso esta perfectamente claro...
- No te preocupes, le respondí, eso esta bastante claro
- Cuando una pareja va a tener sexo, me dijo, no debe olvidar los detalles referidos a calentar a su mujer y hacer que la excitación haga que ella este dispuesta a entregarle todo y sin reserva alguna...
- La interrumpí con evidentes signos de excitación pero procurando no demostrarlo; eso esta también muy claro pero ¿Como hago eso?
- En el caso de cada mujer cada una tiene sus propios límites...
- Eso lo supongo, pero ¿Como saberlos? le dije. Sin dejarla responder le pregunte nuevamente, por ejemplo en tu caso ¿Como es que te gusta llegar a excitarte?
- Me sorprendes preguntando eso directamente, me dijo, No se como decirte esto directamente y sobre todo estando solos en el dormitorio. (En su amplio dormitorio tenían una mesita y estábamos tomando un café allí).
- Pero ya estamos en el tema, me dijo…..así que hablaremos directamente del asunto. En mi caso me gusta que sean delicados y que empiecen dándome besos en los labios, en el cuello, en los senos y que vayan al mismo tiempo desnudándome con mucho amor.
Para esto ella mostraba evidentes gestos de excitación también y se agitaba en medio de cada palabra.
- Pero ¿Como es un beso apasionado por ejemplo para tener sexo luego? Pregunte
-Ella ya turbada me dijo, solo tienes que acercarte lentamente y tomándola por los hombros posas tus labios primero con suavidad y luego los vas abriendo suavemente con la lengua, recorriendo todas las cavidades de su boca....
- ¿puedes enseñarme, por favor? Implore directamente...
Ella dudo y no sabia como salir del tema que evidentemente nos mantenía excitados a ambos...
-Bueno me dijo...pero solo será un momento y solo como una demostración para que sepas como hacerlo...
Ella estaba con un pijama cortito y sin mangas casi transparente; era evidente que no llevaba brasier y que solo tenía una pequeña tanguita que se notaba por la transparencia de su ropa de dormir.
Me tomo de los hombros y acercando su boca a la mía me pidió muy suavemente....cierra los ojos....
-Pero si los cierro como voy a aprender?, Le dije...
-Solo ciérralos y después podrás abrirlos, me dijo..
Así lo hice. Sentí su respiración muy cerca de mi boca y su aliento casi tocaba mis labios. Muy suavemente me dijo abre un poco los labios...
Hice lo que me pidió y ella poso sus labios primero con mucha suavidad y luego al igual que lo que me había dicho, empezó a circular por el interior de mi boca
con su lengua en un beso excitante como jamás lo había recibido.
En ese momento era evidente que no habría retroceso…… que no habría marcha atrás, que algo más que solo eso estábamos deseando...
La tome por los hombros y correspondí el beso recibido pasando mi lengua por la comisura de sus labios, tomando su cara con mis manos y abrasándola muy fuertemente.
El beso fue interminable, largo húmedo y delicioso.
Nuestros brazos se juntaban y circulaban con pasión los de ella por mi espalda y los míos por sus hombros, espalda y brazos ….sin llegar a atreverme más allá todavía.
Fue un beso larguísimo que duro cerca a 5 minutos y que evidentemente hizo que mi verga se erectara y que sus pezones so notaron erectos igualmente.
Al terminar ese primer beso nos miramos en silencio y sin decir palabra alguna ella se levanto y apago las luces para dejar la habitación semi oscura...mi excitación no me permitía pensar, estaba realmente cachondo y con ganas saltarle encima..pero ¿Como hacerlo, como tocarla, como moverme?
Abrió ligeramente las cortinas para que entrara un poco de luz y se acomodo nuevamente en el sillón a mi lado.
- Voy a enseñarte algo que deberá quedar solo entre nosotros, me dijo..
- Te lo prometo y juro por lo que mas quieras, le respondí rápidamente.
Se quito entonces la parte superior de su pijama y surgieron unos senos hermosos, medianos y perfectos como solo había visto en mis sueños...sin mediar palabras me acerque a ella y se los tome suavemente besándolos con desesperación mientras ella acercaba más mi cabeza a su pecho...
- Me gusta lo que haces....me encanta que me beses, me haces sentir muy rico...dijo suavemente
- Yo trataba de contener el aliento y seguir con mi tarea.
Sus pezones crecieron una enormidad y se pusieron muy duros….. ella empezaba a gemir y se recostó sobre el mueble. Me puse de pie entonces y me quiete rápidamente la camisa y le dije..
- Quiero que me beses en el pecho tu también…… quiero sentir tu lengua en mi pecho, quiero sentir tu calor húmedo en mi pecho....
- Acércate me dijo y empezó a chuparme el pecho con suavidad y gozo.
Estaba yo disfrutando al máximo cuando sentí que su mano comenzaba a acariciar mi verga por encima del pantalón. Esta había crecido a casi los 15 centímetros de su totalidad en ese entonces.
Me estaba corriendo una deliciosa paja por encima del pantalón sin atreverse a cogerla directamente.
Impulsado por esa acción baje mis manos y comencé a frotarle su sexo por encima de su breve pantalón del pijama, con suavidad y desesperación igualmente.
Yo tenía que ser más atrevido si quería llegar a algo más.
Así que deslice mi mano muy suavemente por un costado del pantalón y le comencé a acariciar la conchita por encima de la trusa...ella ya no daba más...seguía frotando mi verga aunque con mas atrevimiento y fuerza.
- Esto no era parte de la lección....esto no creo que este bien...decía más por compromiso que por que lo pensara realmente.
-No podemos detenernos ahora, le dije. Quiero aprender todo en un solo día....
-No me dijo y me empujo con suavidad....me quede sorprendido y algo triste....
Nos veíamos raros casi desnudos, excitados y sentados… ahora, separados uno del otro.
No creo que este bien que nos quedemos así, le dije. No creo que sea justo para ninguno de nosotros...
-Pero tampoco esta bien que continuemos por que luego tu querrás metérmela y yo no se si podré detenerte, me dijo...
Porfiamos, discutimos, seguimos hablando y tratando de ver como salíamos de esta.....estaba desesperado y la erección de mi pene no bajaba, lo que me produjo algo de dolor. Esto se lo comente y ella se preocupo mucho.
-¿Que es lo que te duele? Me dijo
- Mi pene, le dije directamente...
- Pero es que no podemos continuar, me dijo...
-Pero es que me sigue doliendo, le dije yo....
Bueno entonces...me dijo.
-Hagamos un trato..ya hemos llegado hasta aquí y yo no se que pasara luego..pero por ahora solo trataremos de desahogarnos de esta excitación pero sin llegar a que me la metas directamente. Jugaremos, nos frotaremos, nos correremos la pajita...todo pero sin llegar a metérmela...
-Bueno le dije yo ¿Que podía hacer en ese momento? y retome de inmediato mis caricias.
Le quiete el pantalón y se quedo solo en tanguita...tenia un cuerpo joven y hermoso, el mismo que devore con mis besos...le chupe nuevamente los senos….baje hasta el ombligo y le pase toda mi lengua por encima de su trusita sin sacarle nada y con el evidente propósito de hacerla estallar de excitación...
-Me encanta lo que haces...sigue así suavemente sin detenerte, quítame la trusa y chúpame el clítoris..me imploraba ahora…..
Yo era dueño de la situación entonces...
Me pare me saque rápidamente el pantalón y solo con el slip me monte sobre sus pechos poniendo mi erecta verga cubierta solo por la ropa interior frente a su cara...hazme lo mismo casi le ordene...
- Tienes derecho a sentir lo mismo, me dijo y empezó a pasar su lengua por todo lo largo de mi verga sin sacarme la ropa interior.
Estaba es eso momento con los ojos cerrados así que yo aproveche y sin que se diera cuenta en un movimiento rápido saque mi verga por un costado y se la puse desnuda frente a sus labios.
-No eso no, así no....todavía no...por favor...me imploraba.
Pero ya no había marcha atrás, no me quedaría así....con suavidad le di un largo beso en los labios y le dije
-¿Nunca los has hecho, nunca se la has chupado a nadie...?
-Solo una vez me dijo...aunque me gusto no me atreví a hacerlo nuevamente...
-Pues aprovecha ahora, es mi forma de agradecerte por lo que me has enseñado, le dije....Me levante nuevamente y lleve directamente mi verga a su boca....
Me miraba con desesperación pero evidentemente excitada....por favor hoy no, me suplicaba....
-Me baje nuevamente y con suavidad comencé a quitarle la trusa y me deposite suavemente entre sus muslos sin exigirle más....yo iba a hacérselo primero y demostrarle lo rico que podía ser eso.....
Pase mi lengua por el ombligo mientras ella temblaba....fui besándole la parte interior de sus muslos mientras que un dedo buscaba que acariciarle la conchita...estaba empapada...ya no aguantaba mas....
-Por favor no lo hagas...si sigues ya no podré detenerme, me decía....
Seguí besándole hasta que llegue a sus labios interiores los que comí con desesperación..ella se revolcaba y movía desesperadamente en el mueble.....a la cama me dijo...vamos a la cama....
Desnudos pasamos rápidamente a la cama en la que nos acomodamos nuevamente en un cóncavo y convexo 69 perfecto. Aunque sin obligarla a chuparme mi verga......solo yo lo hacia...
-Me gusta lo que haces, siento riquísimo, nunca había sentido esto, me decía.....
Yo seguía comiéndome su coñito y haciéndola vibrar intensamente...
En ese momento ya no aguantó mas y me dijo......te haré lo mismo….. y suavemente comenzó a comerse mi verga....que sensación mas rica y caliente era eso....
Me encanta lo que haces, esta vez se lo grite yo ...
No hables sigue haciéndolo tu también que yo me comeré tu verga......¿Verga? Mi adorada y delicada Alejandra la había llamado por su nombre, me había casi gritado ¡Verga! ...estaba muy excitada...
El fellatio fue interminable, desesperado, inigualable...labios en mi verga, mi lengua en su concha.....
-Quiero comerte la conchita le decía...me encanta verte arrecha y desesperada por mas....
-Si cómeme toda la chuchita y pásame el dedito rico, me dijo ya sin temor mi Alejandra...
Así lo hice...nos chupábamos con desesperación y tremendamente excitados.
Varios minutos después sentimos que ya estábamos a punto de llegar.....
-Ya voy a llegar me dijo...si quieres sal que no quiero........
-Llega en mi boca, quiero chuparte toda…… no te preocupes quiero conocer tu sabor....
No me sigas hablando así que me muero....
¿Acaso tu no quieres mi lechecita? le dije....
-Si por favor dámela....me dijo ya sin miedo...dámela toda que me la quiero tomar íntegramente....
Seguimos chupándonos, lamiéndonos...haciendo el amor con nuestras lenguas....
Explotamos finalmente….. Convulsionamos, gritamos y temblamos juntos.......era el cielo..era lo mas divino para ambos....era una demostración hermosa de amor.
Quedamos en silencio……… exhaustos uno al lado del otro..
¿Que hacer ahora me preguntaba yo?
- No te vayas hoy....quédate a mi lado y duerme conmigo (me dijo con una suavidad y ternura incomparables)…….. esto ha sido muy hermoso y quiero prolongarlo hasta mañana.
Así lo hicimos permaneciendo uno al lado del otro. Amanecimos cansados pero felices...nos dimos un largo beso y nos despedimos no sin antes prometernos repetir el encuentro en la primera oportunidad que tuviéramos.
Yo había aprendido mucho ese día y ella también, ambos estábamos satisfechos.
LuisMi





en el ambiente el fellatio es conocido como wawis ,golo golo, y los gays sabemos como dar uno bien dado es mas contribuiremos aportar mas al manual q esther a dado el q desea practicas dejar correo no mas jejeje

Lo mejor de una mamada: cuando besan y succionan con delicadeza y luego estrujan con rapidez!

Lo peor de una mamada: cuando muerden por las ganas de jorobar.

HOLA ESTHER, FELICITACIONES POR EL BLOG, SABES, DEBO CONFESAR Q MUERO DE GANAS POR QUE MI ENAMORADA ME LO HAGA, ES DECIR ME LO CHUPE, PERO ELLA ES ALGO MOJIGATA, SIEMPRE ESTA CON ESO DE "INSANO", "INMORAL", ETC, Y A MI YA ME FASTIDIA, SE Q EL SEXO NO ES TODO, PERO ES PARTE DE UNA RELACION, Y ADEMAS ES RICO, CLARO Q SI, Y SI LO HACES CON ALGUIEN Q AMAS MEJOR, DOBLEMENTE RICO, BUENO, DEBERIA SER ASI PARA MI, PERO NO LO ES, ASI Q LLEGUE A UNA DETERMINACION, DE Q ESTA NOCHE LE PLANTEARE EL TEMA, ES MAS LE HARE LEER TU BLOG, A VER SI SE PONE PILAS, Y SI NO PASA NADA, ENTONCES ME ARRANCO, HE DICHO
LANCELOT

Hola Esther.
Ojala todas las lectoras que lean esas instrucciones se lo memoricen y lo pongan en practica.
Las parejas que he tenido han sido buenas en ese arte, aunque hubo una que tuve que darle “instrucciones” porque agarraba mi miembro como si fuera una manguera. Pero hubo una morocha que era toda una experta su lengua parecía una víbora hasta me untaba “mermelada” y “helado” para lamérmelo y cuando pasaba las puntas de su cabello rozando la cabeza de mi pene era el cielo. (Donde estarás Karol) .
Y sobre esa noche de Chat hazlo rápido para que estén contentos todos esos “aguantados”.

siempre leo tu blog esther, pero despues de este exito me atrevo a comentar, no sera la unica vez, soy seguidor tuyo asi como de marie curie, mafer, sincera bebita69 y demas seguidores.... en cuanto a la pregunta, a mi pareja le gusta mas q la penetre, antes practicabamos mas el oral, pero tuve una amiga q le gustaba mucho succionar mi miembro y otra q me lo hizo como nunca nadie me lo hizo, parece q conocia del manual, siempre las recuerdo, buen post esther y me uno a los seguidores tuyos en pedir ahora el manual del cunillinguis como para equilibrar las cosas....un beso esther

Hola ... me pueden decir?.... una vez que se eyacula ....toda la leche en la boca de la protagonista y te da un bveso apasionado y te pasa toda la leche .... que tal es?

a mi siempre me seca la boca... algun consejo?

A PRACTICAR SE HA DICHO

MISMA G....

Un vasito con agua cerca Marta, y a continuar

La consulta se debe elevar a nuestras parejas la hice y dijo que sí, sólo que a veces en la calentura lo rastrillo con los dientes, después de tanto tiempo… todavía novatadas, caramba.
Técnica. Descubrí aquí y allá: que les gusta vernos en actitud sumisa (me arrodillo), que atendamos la cabeza ( paso los labios la lengua y succiono ligeramente), ver que la comemos con ganas (me la como un bocatto de cardenale), les gusta ver la lengua trabajando (serpenteo con ella), les gusta que abramos la boca y nos la engarcemos toda (hasta donde quepa y todo afuera), a mi marido le gusta que fije mi palma en su vientre, nunca olvido los huevos…ambos, si se deja le acaricio el ojo del culo, que usemos los senos para acariciar (paso la cabeza por mis aureolas y pezones), tragar la leche. Esto último sólo lo he hecho con mi marido el sabor es ligeramente dulce, algunos lechazos me han provocado arcadas, gajes del oficio. Les gusta venirse en los senos (yo misma le agarro la verga para que llene de leche mis senos).
A mí me gusta ver como queda mi marido después: con escalofríos, temblando. Me abraza y dice: “mujer… me lo sacaste todo”
En nuestras primeras veces se sorprendió cuando vio que lo disfrutaba, parece que con chicas anteriores no percibió eso. Cuando mamo sólo hago eso hasta que se venga, me di cuenta que si hay penetración eyacula muy rápido y quedo empezada.
Mi asunto era el 69, rehusaba hacerlo porque siempre soy la primera en abandonar la causa, pensando en que dar y recibir era el tema…evitaba. Mi marido me pedía y pedía hasta que hace muchos años le dije porque no lo hacía y él lo resolvió en un tris: “si no puedes seguir no sigas …que yo si sigo”.
Mamar… lo disfruto mucho, me gusta ese olor de hombre personalísimo, me mojo al hacerlo quedo increíblemente excitada.

cuando una mujer ama a un hombre lo hace esplectacularmente... el detalle está cuando uno esta en una relación cuando el hombre no nos inspira nada de nada........ uno ya lo hace más por compromiso... por eso hombres ponganse las pilas den para que recibannn

Bueno, mi querida Marie Curie, ya tienes más fans, creo que si haces to propio blog, Estercita tendría una buena competencia. Cada vez que leo tus comentarios es como si te estuviera viendo en dvd, en mi cuarto, a oscuras, solo.

La única que me lo ha mamado bien hasta ahora fue una profesora de religión, colega del trabajo, que siempre que hablábamos de la vida sexual de los chicos se hacía ascos, "ay, qué cochinadas hacen los chicos". Mamaba como una actriz porno, o mejor todavía: empezábamos por los besos, después bajaba por mi cuello y se concentraba en mis tetillas, al principio me hacía cosquillas, pero después me fui acostumbrando, mientras me besaba, me acariciaba el miembro, que ya estaba duro, seguía bajando hasta que llegaba a mi sexo, le daba un beso a la cabecita, después se lo tragaba, solo la cabeza, lo chupaba, succionaba, lamía, mordía, me gustaba sentir sus dientes hundirse ligeramente en mi miembro, después barría con la lengua hasta la base, se tragaba los boliches, volvía a subir y terminaba metiéndosela todo hasta el fondo de la garganta, subía y bajaba como si estuviera montada en mí, ese era uno de los picos más altos de sus mamadas, a veces yo le agarraba de la cabeza y se la metía y sacaba como si le estuviera haciendo el amor por la boca, ella feliz con los ojos bien abiertos, luego me me apretaba el miembro por los costados y subía y bajaba en esa posición como si me masturbara con la boca, también hacía un alto para hacerme un ruso, ya estaba tan excitado que el lubricante salía como agüita, ella lo limpiaba con la punta de sus dedos y luego volvía a su afán y no paraba hasta que terminaba dentro de su boquita caliente y húmeda.
Después conocí a una chica a quien enseñé a mamar. La primera vez que le pedí que me la chupara me dijo no me gusta chupar ni que me chupen. Es que no sabía, ni le habían hecho la sopita. Yo le enseñé, la primera vez estuvo como diez minutos de rodillas frente a mi miembro, le pasó la punta de la lengua y dijo qué asco, es muy salado, apesta, yo rogándole para que me lo hiciera, hasta que al fin se animó, no sabía hacerle, así que le di algunas lecciones y aprendió y le gustó, porque algunas veces nos encontrábamos y me decía hoy solo te lo chupo porque ando con dolores de ovario y me daba unas mamadas que me hacían ver las estrellas.
Hay mujeres a las cuales el fellatio les da asco como si fuera pecado, y no lo es, es parte de la sexualidad, porque el sexo también es para disfrutar, ¿no?, no solo para traer hijos al mundo.
Lo principal es tener el miembro limpio, y enseñarle a la mujer si no sabe, tampoco esperar que sea una actriz de cine porno en la primera sesión. Si es con una 69, mucho mejor, los dos gozan al mismo tiempo.

El sexo oral es muy importante en una relacion sexual... este debe ser inicialmente muy lento y cohibido... y luego rapido y desenfrenado ... como bien lo narran aqui ... el estimulo del perineo y del ano es fundamental para encontrar un orgasmo epico e inolvidable...

holaaaa FIORELA creo k el de asco se pierde con la practica si pero eso si haslo `pero cuando tengas ganas no cuando no te da ganas por k si no sep eude poner peor la situacion per obueno el las mamadas son muy ricos y exitantes para anbos pero las k lo haces por ver al hombre recontra exitado no lo hace n por placer si no por joder se peude decir asi

Para
Lorena creo lo k hace tu enamorado esta muy mal si lo haces es por k te gusta no por k te lo obligen asi es , ahi solo el k se exita y la pasa bien es tu enamorado.
Es como tu lo dices el solo piensa en el y no k tu la pases tambien

Bueno es muy placentero cuando tu pareja te lo haga pues no todas saben hay algunas k lo hacen muy pecimos pero algunas si lo saben hacer y k digamos muy bien hay una amiga es la unica la k me la hizo muy bien se peude decir k me hizo sentir en el paraiso como si fuera la exitacion mas duradera k aya sentido .....
k tendria n k hacer para k les ponga 20 creo k solo k lo hagan con muchas ganas y esmero si asi es ....`pues bueno ya me retiro por k ya estoy humedo con solo recordar las experienzas k e tenido chauuuuu

espero un chat pasen la voz nada mas asi k

hola amigos.
muy buena, me puso muy caliente, bromas aparte que pasa cuando mi esposa no deseo ni desea saber nada del oral,

Gracias al cielo la persona con la que estoy sabe como mamarla. Antes no lo sabia pero con guias que le llevava (peliculas y recortes) aprendió rapido y ahora es una experta. Como tu dices no solo tienen que concentrarse en el pene, tambien en los testiculos, en el ano. Chessss es lo maximo.

SABES ESTHER PARA EVITAR CELOS TAMBIEN DEBERIAS ESCRIBIR SOBRE LA CUNILICCION(CUNNI LINGUS)O SEA COMO HACER PASAR MEJORES NOCHES CON LA PAREJA
ESTE CUNNI LIGUS ES LA CONTRAPARTE DEL FELLATIO(FELACION)

UYYYYY!!!Me descubrieron Esther, que hago????una amiga del trabajo vigilo mis coment`s. ahora lo pero de todo me mira con ojos deseosos....mmmmmmm

CHICAS NO MUERDAN, A LAMER Y CHUPAR, PROHIBIDO MORDER, TE ENCANTARÍA QUE TE MUERDA EL CLITORIS? VISTE, LA COSA ES IGUAL

Hay una buenaza, "la boxeadora" a la vez te hace el fellatio te va metiendo puñetes en las bolas, es lo máximo.

Ay que rico...morder con las encias
me entran ganas...

Creo que lo hago bien , mi pareja siempre eyacula cuando le hago sexo oral , lo que mas disfrutamos ambos es hacerlo mientras el maneja,(cuando vamos por alguna carretera) empiezo con mi mano inquieta acariciando su pene caricias muy suaves cuando siento que esta en erección abro el cierre y meto mi mano y sigo con las caricias luego desabrocho el boton y saco el pene le doy unas lamidas largas, juego con la cabeza como si fuera un chupete y luego me la meto toda en la boca sigo con los masajes con mi mano cojo fuerte el pene que esta duro y muy erecto y muevo mi mano hacia arriba y hacia abajo como cuando se dan una paja eso le encanta mientras hago este movimiento yo chupo la cabeza y meto la lengua en el ojito y siento que eso esta a punto de explotar continuo ocn los movimientos de mano mi boca chupa la cabeza la succiona fuerte y hago que se moje y me trago el semen , amo a este hombre y el disfruta de mis locuras y me ama.

Comparando entre boca de hombre y mujer. los hombres son mas lenguones. pero las chicas por los labios. Lo más rico es un trío en que tengas las dos bocas.

Muy buen tema Esther te felicito cada semana tienes algo interesante en tu blog.
La verdad que cualquier mujer te pudede dar
una mamada pero son muy pocas las que en verdad lo saben hacer. Gracias a Dios encontre a mi amorcito ANITA que lo hace de maravillas y me hace sentir cada vez mas cerca de las nubes cuando me lo hace.
TE AMO ANITA>

Kina ¿puñetes en las bolas?... paso, eres muy brava para mi; yo no podría estar con una mujer que no sepa o no le guste hacerme un sexo oral, definitivamente no me pienso perder ese placer por una tonta caprichosa ó "puritana", no vá conmigo, en todas las parejas solo dos, Alejandra Andrea y Consuelo, nadie mas ¿por qué? simple, por que amaba hacerlo, tanto o más como sentir a su hombre dentro de ella, ese es tal vez el secreto, te debe gustar, sin perjuicios ni asco ni tonterias, el sexo es así, si no ¿Como?, amaban hacerlo, les gustaba hacerlo, se deleitaban hacerlo, sentir el pene duro y suave en sus labios, ver a su hombre disfrutarlo y gozarlo, desesperarse para sentir el chorro seminal y tomarse la esencia del hombre, como dicen en la serie sex and the city "los hombres nos podrán tener arrodilladas, pero nosotras los tenemos donde queremos..." filosófico, saludos Esther.

CREO QUE ES ALGO NORMAL ENTRE LA PAREJA QUE REALMENTE SE AMA POR QUE NO HAY LIMITES PARA EL AMOR ,CREO QUE ESO ESTA PERMITIDO EN LAS VERDADERAS PAREJAS .A MI EN PARTISULAR ME ENCANTA HASERLO CON MI PAREJA POR QUE SE QUE EL LO DISFRUTA YA LO COMENTO DISE QUE SE SIENTE EN LAS NUVES Y PARA MI ESO ES LO IMPORTANTE QUE A EL LE AGRADE Y A MI TAMBIEN ES UNA HERMOSA EXPERIENCIA CUANDO LO ASES CON LA PERSONA QUE AMAS
TE AMOOOOOOOOOOOOOOOOOO RAFAEL

Kina ¿puñetes en las bolas?... paso, eres muy brava para mi; yo no podría estar con una mujer que no sepa o no le guste hacerme un sexo oral, definitivamente no me pienso perder ese placer por una tonta caprichosa ó "puritana", no vá conmigo, en todas las parejas solo dos, Alejandra Andrea y Consuelo, nadie mas ¿por qué? simple, por que amaba hacerlo, tanto o más como sentir a su hombre dentro de ella, ese es tal vez el secreto, te debe gustar, sin perjuicios ni asco ni tonterias, el sexo es así, si no ¿Como?, amaban hacerlo, les gustaba hacerlo, se deleitaban hacerlo, sentir el pene duro y suave en sus labios, ver a su hombre disfrutarlo y gozarlo, desesperarse para sentir el chorro seminal y tomarse la esencia del hombre, como dicen en la serie sex and the city "los hombres nos podrán tener arrodilladas, pero nosotras los tenemos donde queremos..." filosófico, saludos Esther.

esther una consulta y de verdad espero la respuesta el usuario ELTROVADOR es el mismo usuario que comento blogs atras con el seudonimo de ELTROVA espero tu pronta respuesta gracias y sobre el tema es buenazo yo tengo 2 amiguitas q me lo hces resuper bien ademas chicos les doy un tips para los q puedan hacerlo q 2 chicas se lo hagan a la vez, dos bokitas en tu munekito es fabuloso gracias besos esther

Me siento super gratificado cuando mi pareja me hace un oral, es lo máximo, me siento en el aire, ella lo sabe, yo trato de retribuirle y le hago un oral tambien, pero ella solo resiste unos pocos minutos y luego me pide que vaya al sexo tradicional. No se si ya esta muy exitada o tal vez lo hago mal???, en fin, lo cierto es que esto lo hacemos como un previo y nos ayuda (sobre todo a mi) a durar mucho más tiempo. Lo disfrutamos mucho.

Le pondría 18 de nota a mi pareja.

Para ponerle 20, falta muy poco.

Saludos Esther, buenazo el tema, estoy seguro que ayuda mucho a la parejas un poco pacatas.

Hum, que tema tan interesante! Con lo que me gusta esa actividad. Gracias Esther, no sabia que existian instrucciones.
Con mi pareja me gusta tambien succionarlo y lamerlo como helado y mientras tanto, de rato en rato, mirar a los ojos para ver como cambian por la excitacion y dejar ver como cambian los mios por el placer...

peke me encanta verte desnudo y empezar a besarte abajo, no sabes como me gusta, me vuelve loquita tu olor.
pk

hola esther , bravazo tu post me lesite el pensamiento hace time busco informacion al respecto he buscado en la red pero nada ni los videos creo q fingen... y ahora con esos consejito y el de los chicos creo q estoy lista para darle una buena mamada a mi hombre, aunk te confieso q nunca me ha gustado hacer eso solo se lo he hecho a un hombre y eso porq era su cumple y yo estaba en falta ...ahora he decidido hacerlo pues el se esmera mucho en el cunilinguis y otras cosas como poses y estimulacion el es un excelente amante y yo me estoy kedando ... asi a la taque! jeje

La verdad, lo hace bien, pero empezo sin saber nada. Darle clases a la mujer sobre estas cosas es una de las pocas cosas que resulta satisfactorio, y disfrutas hasta de los errores.
Mi pareja por ejemplo le tenia como que un poco de asco, despues dijo que le empezo a gustar y que el liquido que salia del semen era dulce, y le empezo a gustar mas. Ahora lo hace considerablemente bien, aunque el semen se seca de una manera tal que cuando eyaculo sobre su cuerpo o su cara le arde un poco. Por eso he preferido cortar el oral y pasar del oral al sexo propiamente dicho.
Otra cosa muy buena es lo que llaman 69, porque es notoria la reaccion que mi dedo provoca en su boca, si es que me entiendes.
Buen tema, y en sintesis, no son expertas, pero...que aburrido seria si lo fueran.
Y sí a ver si posteas algo sobre el sexo oral hombre mujer...no se como se le dice...cunnilinguis?, como sea, creo q es la mejor manera de entender mas o menos lo que ellas disfrutan haciendonoslo.

Esther; Como siempre interesante tus comentarios asi como los aportes de tus fieles seguidores. Desde el punto de vista gay....es una grata experiencia que siempre la realizanos,,,no saben como se disfruta hacerlo es parte del ´´paquete´´ que uno ofrece a su pareja. Te cuento mi primera experiencia...yo con 17...años..el de 25...yo no sabia nada del sexo oral...el que fue el primero en mi vida....(Lo hicimos sólo dos veces)..me lo pedia..pero nunca se realizó..sin embargo con Omar fue distinto el sabia lo que hacia...era un experto en las artes de amar..sentí tanta confianza y excitación que cuando me lo propueso sólo le respondí: ´´Como lo hago´´...tuve paciencia, en enseñarne...me tomo de la mano se lo metio la boca y comenzo a jugar con su lengua,,,una y otra vez.....nunca lo olvidare....casi me atraganto....pero es bello sentir algo duro y caliente entre tus labios,,,atender a tu pareja ...que excitado se entrega ....es fabuloso
Saludos

PAra Ariana,
Excelente tu manera de mamarla, excelente y me gustó tu franquesa, tu pareja debe estar contento contigo, sigue asi amiga

Chicos sean comprensivos.
Primerizas…lo primero que debemos superar es el impacto visual de una pinga parada, ni siquiera estoy hablando de los 3 patas, de uno normalito. A mi me tomo tiempo mi chico guiaba mi mano allí y yo sacaba la mano…dulces 17.
Lo de mamar fue otro proceso creo que la técnica es muy primitiva al inicio, no sé las demás pero a mi no me gustó para nada en un principio, pasó tiempo y varios amantes. Entonces llego el muchacho de la película que me hizo sentir la sangre en las venas. Cuando una está complacida quiere reciprocar y por primera vez me agradó mamar.
Creo que los hombres al igual que una se dan cuenta cuando lo acariciamos sin ganas, batallando con el asco, con el olor o lo que fuere. Me pongo a pensar en el olor de la vagina aunque esté aseada y libre de infección es muy fuerte, pero a la mayoría de los hombres les gusta, sin embargo conocí a uno que no le gustaba…no bajaba ni quería que yo lo mamara; ese sexo sin mamar fue como pizza sin mozzarella.
El olor en los hombres también es fuerte, chicos no pidan que una mame si vienen de jugar futbol o todo el día en la calle, un bañito…limpiecitos ambos…que vengan los rumberos.
Debemos buscar la forma en que nos agrade sino es un suplicio. En su defecto es mejor no mamar…si a una no les gusta mamar…se dan cuenta y el propósito de complacer se pierde.
Me gusta hacerlo él de pie yo de rodillas uso los dedos primeros luego la boca y los senos, una vez le puse helado; el frío trajo una reacción interesante cuando sintió el calor de mi boca. Lo dejo venirse en mi cara y mi pecho hasta en el cabello me ha caído. Él se relame cuando retiro la leche que queda pegada a él.
Con mi hombre es parte de nuestra vida sexual. Disfruto el hacerlo, magnífico ese 69.

Interesante las instrucciones, a mi pareja como a muxhas, no le gusta mamar el pene, pero como consejo a los chicos les digo que si ustedes le besan el ano mientras ella se los mama, uff veran que se alocan tanto que se quieren tragar tu pene en one. saludos!!1

Esther excelente post
muy didactico directo como para animar a las principiantes a hacerlo
mi pareja me lo hace muy bien no se como se convirtio en una experta en fin seguro leera igual que yo
Para poner un 20 estoy casi seguro que muchos coincidiran conmigo
1.-es que te hagan la Fakir osea que se lo traguen todo (incluyendo testiculos)
2.-que te miren a los ojos mientras la chupan
3.-NO METER DIENTE
4.-tomarse todo el semen y seguir chupandola hasta que el pene este totalmente agotado

ojo aquellas chicas que roban;que te masturban y solo chupan la cabecita ; nos damos cuenta es por eso que muchas veces les cogemos la cabeza y hacemos que se traguen todo .....no contaban con nuestra astucia
Interesante lo del chat me parece muy bueno encontrar un lugar para poder conversar de sexo muy abiertamente creo que primero seria el CHAT y luego una FIESTECITA seria mostro poder conocer a tantos referente de este blogs
aunque de echo muchas de las chiks se echaran para atras porque es mas facil estar blindado por un chat que estar dispuesto/a a un encuentro carnal interesantes las dos ideas pero en realidad me es mas facil el chat y que de ahi pueda pasar algo es cosa de cada uno

saludos a todos
y a chuparla chikas

estoy seguro que ya les tocara a ustedes

Hola! Esther:

Sólo para compartir algunas cosas que de repente complementan el tema.

- Los fluidos corporales (Semen, Saliva, lágrimas, Sudor y Orina) así como las heces de una persona SANA son estériles; esto quiere decir que No tienen bacterias,virus, hongos o parásitos productores de enfermedades. Por tanto, la Felación y el Cunnilingus y en general las relaciones sexuales serán seguras si se realizan con la compañera/o porque es la pareja que mejor conocemos su estado de salud, después de nosotros mismos.

- Todas las secreciones corporales (Orina, fluidos vaginales,Semen) están formadas, fundamentalmente, por agua, sal, azucar y células en mayor o menor cantidad. El Semen, el producto de la eyaculación, ese líquido blanco amarillento , cuando procede de UN HOMBRE SANO es tan inofensivo como su saliva, su sudor o sus lágrimas. El Semen además contiene varios millones de células vivas o espermatozoides.

- Si lo vemos fría y tranquilamente el Semen sólo es unas gotas de agua, a las que se le agrega unos granitos de sal, unos de azúcar y células. Es un líquido sin virus ni bacterias si el individuo ESTA SANO.

- El olor del Semen varía de un hombre a otro, tanto como puede hacerlo el olor del sudor de una persona a otra. Pensemos en diferentes frutas... estás tienen los mismos azúcares pero tienen distintos olores, en función de las esencias que las caracterizan, distinguen e individualizan.

- La felación, hoy en día tiene menos mujeres que le hagan especiales remilgos - porque un pene recién lavado es tan aséptico como cualquier dedo limpio- sin embargo, no todas las que se prestan, bien por complacer o porque les gusta, bien porque las excite y les apetezca, acceden a recoger el semen en la boca y menos tragarlo.

- Algunos hombres hacen de ello todo un caso y todo un escándalo para que la mujer recoja la eyaculación en la boca o incluso se lo trague.

- El reto es: Ud. mi estimado ha probado su propio semen?... Es injusto pedir y esperar de los demás lo que uno no ha hecho, evidentemente por asco. Entonces les sugiero que lo prueben delante de ellas y si, ni aun así lo acepta, lo mejor es que se olvide del tema.

- Es estúpido empecinarse en esta cuestión cuando del sexo se puede sacar tanto y tan variado.

- El Semen tragado No embaraza. El Semen es digerido en el estómago como lo serían un par de cucharadas de yogurt.


Bueno que les puedo dejar es lo mas RICO puede hace una srta.
Pero hay de todo hay chicas que no les gusta por el tema de ASCO o por el OLOR y SABOR.
Pero eso se arregla facil jueguen comprate crema chantatilli o algun otro dulce y a jugar.
Y veran que todo cambia.

Mario. R

En un viaje hace como dos meses mas o menos, sali con mi enamorado y tomamos unos tragos, al irnos al hotel donde estabamos hospedados, como nunca me dio ganas de que se venga en mi boca, nunca lo habia hecho pero tenia una gran curiosidad por el sabor del semen. El acepto muy gustoso, se la chupe a mi manera, creo que lo hago bien, a el le gusta mucho y al final se vino en mi boca, caliente el semen aunque con un sabor algo raro, no es tan rico pero si se puede tomar :D, solo a el se la chupo, nunca a otros ya que me daba asco, con el es muy diferente porque siempre esta limpiecito y huele tan rico que da ganas de todo con el. Aunque para evitar el asco pasarlo lo mas rapido y seguir chupando.

jajaja... iba a poner mi comentario pero de sólo leer los de los demás me comenzó a dar ataque de risa, sobretodo los que se te mandan de hachazo esther. Qui buina.

Bueno lo unico que siempre he tenido que corregir a la hora de la hora es cuando la chica pone los labios duros alrededor de los dientes y mueve su cabeza de adelante hacia atras. Eso no guta.

Otra es a la hora de hacerles perder el miedo, por ejemplo poniendole un sobrenombre. Así le agarran confianza.

Despues depende de la chica y no hay que pedirle un standar de calidad a todas. Tienen que imprimirle algo de su personalidad y asi es más rico. Asu eso me pareció bien fiosófico no? Me asusté yo solito.

Ah y para las que les da asco estan lo condones de saborcitos. Esos tienen buena acogida y sorprenden pero solo en casos de emergencia.

Bueno bye sister.

Hola. Ella es perfecta. Lo hace por amor y por vocación. Me encanta su estilo. Me trastorna, en realidad.

No se si su técnica tiene un nombre, pero bien que lo podría patentar. Es perfecta.

Creo que 20 no es suficiente. Tal vez pienses que exagero, pero es verdad. Es felina, es dulce, es complaciente y vigorosa. Me lleva y me trae. Me empuja y me sostiene. Lo peor, o lo mejor, es que me dejo llevar. Soy un niño entre sus labios.

¿Donde estás Mariana?. Leer este post me ha muchas ganas de buscarte una hora antes de lo prometido. Ah, creo que lo de Wolverine puede esperar.

Besos Esther

pucha, tenia problemas con esto justo ahora, ajja
el fin de semana se lo ago como debe ser ajaja
un beso a todos , al comienzo lo vi y lo note sucio, pero despues mmmm , i novio estara contento ajajja

bueno al inicio siempre creo las mujeres no saben pues como es el asunto, chicas hay q practicar ja ja bueno pero el hombre tambien debe guiarlas xq sino uno puede pensar q ha sido toda una experta con otros,y eso ya da q pensar no??.....pero si es bien rico venirse alli ah y q ellas se la tomen toda a una ex le gustaba tomarselo je je muy ricoooo

A ver chicas una mamada que se respete debe durar por lo menos unos 10 minutos, pero eso si parando de vez en cuando para que el ni;o no se emocione demasiado y se venga tan rapido. Ahora diez minutos de rodillas sobre el suelo basta para que duelan asi que les recomiendo sobre la cama, el tratara de mirar de todas maneras ademas de esa forma mirara la curvatura de tus nalgas y eso le gustara mas. Otra cosa muchos hombres no han descubierto los placeres de que le succionen o le hagan el aleteo de mariposa en los testiculos, se los aseguro les fascinara. El perineo es una zona mas delicada y debes intentar ahi de a pocos te garantizo q despues de 10 minutos en su falo y otros cinco en sus testiculos, estara totalmente desarmado y asi podras iniciar el asalto al perineo sin problemas unos 2 minutos ahi, eso si sin dejar en ningun momento de estimular el pene con tus manos. Pero lo mas importante disfrutar del momento, todo esta en la mente chicas y si empiezan a quitarse todo ese "asquito" les encantara, yo me he venido varias veces solo chupandosela. y cuando no me vengo.. me recontramojo. asi que practique practique, que la practica hace al maestro.

(El Verdadero Poseidón)

Pucha, que puedo decir... Hace tiempo que no comentaba. Hace 3 días, sin haber leído este post, me di una sesión con mi compañera de residencia. La verdad que nos teniamos ganas como hace 2 semanas pues con ella surgieron los temas de cama.

Me causó grata impresión pues fue la primera chica con la que lo hago que lo primero que hizo cuando me quitó el pantalón fué irse directito a mi pene en plena erección.

No he de negar que me sorprendió la rapidez con la que su boquita empezó a meterse a mi amigo dentro. Hacía como 2 meses que no lo hacía y pues el calor de su boca me hizo ver estrellas... Le dí duro a la rusa, creo q se palteó porque me mira con verguenza, ja ja

Que rico tema... QUE RICO, en verdad

Yo recuerdo a Gloria, ella me dió la mejor mamada de mi existencia. Dijo que me lo merecía, por que yo le practiqué sexo oral por casi dos horas sin detenerme...le encantó, las noches siguientes, lo hicimos igual. No funcionó el 69, ninguno se logró concentrar. Tienes que saber dar para recibir. Es importante que te miren mientras lo hacen, que se recojan el pelo y que te hagan sentir que les gusta...por cierto lo del sabor, varía de acuerdo a la dieta del sujeto...si tienen dudas, saquen las proteinas una semana de la comida de sus parejas y notarán el cambio de sabor, díganles cual es su proyecto de investigación...estoy seguro que todos seremos conejillos de indias...al menos yo me dejo...

pucha la mejor mamada hace 12 años en Chorrillo una compañera mia,en su casa . La flaca me desbrochaba los pantalones y me la mamaba tragandose todo el semen y volvia a chupar una y otra vez...mamaba mejor que una puta y gozaba. Tuve que dejarla porque ya estaba harto de ella,pero nunca olvido sus chupadas.Tengo novia que no sabe como ella pero mi novia es chica seria y ella es un recuerdo,sabran lo que las conocen ...que mamadas les hara.

Hola estimada Esther:
Acabo de leer tu manual y a la vez de compartirlo con muchos compañeros y compañeres, más dedicada a estas últimas para que no se tan ingenuas y se dejen que tabues. Pero, estoy seguro que más que ellas, serán sus enamorados los que estarán más felices...je,je.
Saludos y muchas gracias por los datos.

Hay otra buenaza, "el escape"
con las piernas arqueadas y mientras te hacen el fellatio te meten un plátano por el ano. No sabes por donde la vas a dar, lloras de placer.
Tienen que probarlo, es lo máximo.
de preferencia usar plátano para chifle.

Muy buen tema Esther, si alguna chica me hace ahora una super maamda sabré que es lectora de este blog y como dice Gaby las chicas deben dejarse de huachaferias y encontrar el gusto en una buena chupada q hasta un orgasmo les puede provocar y feliz los dos(o tres)
Ahora solo falta el manual para la sopita y no me refiero a una receta de cocina, uno sabe pero siempre es bueno saber mas

Bueno yo con sto del sexo oral tengo experiencias y experiencias… de todas las chicas que me lo han hecho solo 1 me a satisfecho completamente y peor es que solo Sali con ella 2 veces.
Mi pregunta iba por otro lado que tal vez va conectado con el tema y es el sgte:
Cuando no estoy erecto mi pene puede medir algo de 2 o 3 centímetros parece de un niño de 5 años (a mi no me importa mucho pero ir a un sauna o bañarse en el gym es medio joda), pero cuando estoy erecto en plena faena llega a 16 o 17 y bien grueso (lo de grueso lo digo xq siempre mis parejas me lo han dicho), el tema es que cuando tengo sexo puedo estar en el acto sexual mas de 1 hora y no eyaculo—así este muy excitado-- creo que en toda mi experiencia solo me he venido en el acto sexual dentro de una mujer 3 veces, el resto son por masturbación cuando ya mi acompañante de momento quiere que me venga como sea haciendo juegos o poses. Esto es normal tiene algo que ver lo del tamaño inicial del pene con esto o que a veces es frustrante ver a mi pareja venirse muchas veces y yo nada lo disfruto claro esta pero con esa intensidad de venirse los dos juntos aun no lo he vivido.

Quisiera saber si es normal y porque se da mi pareja es feliz y las demás también con esto de durar mucho, pero yo quisiera también venirme en pleno acto no aparte.

Nº3
Como su pareja lo acompañé a una cena. Sabía que después terminaríamos en un hotel. Durante la velada lo provoqué, al oído le pedí sensualmente:
“-Vámonos”-
Él apretaba la quijada y no contestaba.
Después de la cena, esa sobremesa aburrida…uff … y yo con ganas, no veía cuando irnos.
Me sacó del grupo con que estaba y dijo:
“Ven conmigo”.
Me llevaba de la mano casi volando, antes de arrancar el carro me mordió (eso no era un beso) desesperado, empezó a abrirse el cierre del pantalón, incrédula pregunté:
“¿Aquí?”.
“Mami… estoy que reviento”
Me convenció su excitación y la hermosura de su pinga parada, gruesa, grande, blanco como él, la punta de tono bermellón. Humedecí mis dedos con saliva y lo acaricie, traté de llegar a los huevos, él ansioso terminó de bajarse el pantalón. Dejé caer saliva y la untaba delicadamente por su tronco y huevos masajeándolos suavemente. Le abrí la camisa: succioné, lamí y mordí sus tetillas. Con la yema del índice acaricie su cabeza, la verga durísima se movía, él levantaba la pelvis invitando mi boca, no me hice rogar… recorrí suavemente su cabeza con la punta de la lengua.
¿”Te gusta…papi”?-pregunté viciosa.
Él asintió como un autómata.
Buscando excitarlo más pregunté:
¿”Cómo quieres… pídemelo”?-.
No puedo contestar.
La metí toda en la boca hasta donde me cupo y luego la retiraba, mientras acariciaba la piel delicada de sus muslos. Entrecerraba los ojos al abrirlos, él siempre mirando. Encendido se agarraba del asiento, hizo un nudo con mis cabellos con el que guiaba el vaivén de mi cara. Saqué la verga y la pasé por mis labios, él la tomó y golpeteo mi mejilla… abrí de nuevo la boca y me la encajó hasta el fondo y toda afuera cogiendo mi boca. Rezumaba masculinidad. Lo mamé con ganas, de tantas mi boca se llenó de saliva y se escurría por mis comisuras, él tomando aire entre dientes; con su dedo pulgar la limpiaba.
Desabroché mi blusa y le ofrecí mis senos, los toqueteó rudamente… que calientes estábamos . Me incliné, tomé su verga…humedecí mis pezones con la leche primera, intenté meterla entre mis senos pero el control de cambios en medio, el manubrio… que incomodidad de mierda.
Pero él estaba volando alto.
“Esta es mi hembra”-con costo decía.
Supe que estaba a punto de venirse…mi boca abierta… expectante, la leche impactó mi nariz y mis ojos, apenas un poco quedó dentro de mi boca, el resto la introduje con un dedo sin dejar de mirarlo. Él… hechizado…relamiéndose…temblando, acaricio mi cara.
Al rato sacó su pañuelo, secó mi cara: “oh…mami, que feliz me has hecho, te amo”. Ubicó mi cara en su pecho.
“Llévame a un cuarto”-simplemente pedí.

Hace varios dias que leo este blog y la verdad que faltando pocos minutos para mi salida me animo a escribir.
Leyendo todos los articulos me parece de locura lo que leo y los coments q tb suben...
Relacionado a este articulo me hace recordar ufffffffff!!!
Espero un nuevo articulo que suban el dia de mañana...ah y mis felicitaciones para la blogger, creo que "raya" con este blogg!
Un saludo a to2, y naa pasenla super!!!

Gabycita tierne mucha razón cuando dice q es mejor q te la chupen mientras tu estas ehcado en la cama y ella en posición d gata, asi puedes ver: 1. su rostro y 2. sus nalgas, sobre todo si son kebraditas, es genial.

PD: ¿cuando nos vemos Gaby? jejeje, mentira, es broma nomas.

FELLATIO????????
KKKKK SABEN RECIEN ME ENTERO K CHUPARSE UN PENE SE LLAME ASI JAJAJJAJAJAJAJJAJAJAJ
ESTHER TABUENO LOS CONSEJITOS HHEE.....
Y LOS TRUCOS DE HOY EN ADELANTE LOS BOY A EJECUTAR CON EL AFORTUNADO K APARESCA EN MI VIDA XK TE DIGO K ASES MESES NO LA BEO I YA NOSE NI COMO ES JAJAJAJAJAJAJAJAJAJAJAJJAJ¡¡¡¡¡
PERO K BIEN LA DISFRUTABAMOS CN MI EX .SALUDOS EE MIGUELITO TE EXTRAÑO Y MUCHO MAS A TU FALO K BIEN K NOSLA PASABAMOS ........
TOY ANONADADA HOOOOOOOOOO HOOOOOOOOO BAY
ESTHERSITA BESOS TE KELO MOXO.............

de tan solo pensar, ufffff

Que buen tema, aunque se que dejo a mi pareja muy satisfecha con mis mamadas, aplicare todo y algunos trucos mas.

Gracias!!


Marie curie

deberias tener tu propio blog, me gusta leer tus historias

Muy bueno el post, pero creo que deberia haber otro sobre como hacer el fellatio (o no se si se llame igual ) a la vagina de una mujer.

buenas instrucciones ,no sabia que era tan importante el prehambulo aunque mi novio despues de ver esta nota llegò a la conclusion de que soy su 1 en 50 ajajaj que puedo decir ,sera natural esta habilidad .hoy lo comprovara denuevo .

PUCHA IO AHORA NO TENGO HEMBRA PERO TENGO UNA AMIGAZA QUE ME HACE UNAS MAMADAS TREMENDAS ME VENGO EN SU BOCA Y TODO TODO SE LO TRAGA BIEN Y SABEN QUE VOY AIMPRIMIR ESTO PARA QUE APRENDA MAS MI AMIGUITA DE CLASES DEL INSTITUTO GRACIAS

gracias por las instrucciones ,no sabia que este prehambulo era tan importante aunque debo admitir queminovio despues de leer esta nota dice que soy su 1 en 50 jajaj que puedo decir sera una habilidad jajaja ,hoy lo comprabara de nuevo

Pues si, tengo 39, y dejenme decirles que me siento muy gratificado con la boca de mi amada, ella unos 13 años menor, que ha aprendido de todo conmigo, una de las cosas que debo calificar con mayor nota es su entrega y sus ganas de superación, aun recuerdo sus primeras mamadas, algo timidas pero eso si, siempre con ganas, ella nunca lo ha hecho por obligación, y esa es una gran ventaja, ella lo hace por que lo disfruta y al disfrutarlo ella, uff, a mi me pone a mil, otra cosa, a pesar de mi calificación ser excelente, ella siempre busca el mas, asi que mi experiencia con su boca es cada vez mas exquisita y no se hasta donde podria llegar. Te adoro enana, eres lo maximo.

Gracias por las instrucciones.Al inicio obvio que nadie sabe chuparla pero todo depende del hombre q se van a comer o se comen yo Feliz con Javier el me enseñò a Chuparla y poco a poco a ido guiandome como debo hacerlo, me encanta bajar y comenzar lamiendo el glande jugar con mi lengua, meter la boca apara sentirla ahi dentro que tan dura se pone,ir tocandolo todo el cuerpo hasta los pies pero sin dejar de chuparsela ir acariciendo sus huevos, mirarlo para ver que tan cara de arrecho pone(eso me aloca)verlo como se mueve de placer.Creo que para una buena mamada todo depende de las ganas y entrega.Ah!!!pero sobre todo nada de asco; yo si tengo ganas de tragarme la leche pues lo hago y si el me lo pide no tengo problemas eso tambien es rico.Ah!!lo ùnico que me falta es tragarme toda mi Pinga..Pero Javi preparate por que lo harè.
Pero esto solo es un previo para luego tener un buen sexo

qué tema!! das 100pre n el clavo cn esos temas.voy a imprimir ste tema y studiar sta clasesita n.n grazias x existir esthercita

Bueno muy bueno los consejos algunos de ellos ya los he hecho por ejemplo lo de que se venga en tus senos lo maximo a mi novio le fascina el esta contento con lo que hago no soy delicada al contrario me encanta hacerlo todo el tiempo y es bueno siempre aprender algo mas para dar placer asi como ellos hacen su esfuerzo ahi abajo tb se merecen que los concientan si no eres tu sera la primera puta que vean y puedan pagar o no?? jajajaja lo maximo

jajaja asi es señores a todas nos gusta mamarla pero hay una diferencia y es que algunas si la disfrutan asi como yo por ejemplo y si quiere que me arrodille lo hago es mas ni me lo pide pork sabe k me encanta hacerlo y rosarle por todos lados inclusive me pongo minis o me visto como una prostituta para el pork me encanta y a el tb jajaja y me dice que deberia ser una actriz porno que me sale natural jajaja

Hola, el día de ayer salí con un amigo que hace mucho no veia, pues con este chico siempre el sexo fue mas que bueno y ayer parece que nos habiamos extrañado mucho por que estubimos 2:30 si parar, el vive solo pero esta ves no quedo un rincon de la casa que no lo probaramos, y gracias a este blog le di mucha satisfacción y bueno el tambien pero puse en práctica los tips y se moria cuando se la chupaba y lo miraba a los ojos....primera vez que sentía como crecia y se hinchaba un falo dentro de mi boca, guaaaaaaaaaauuuuuuuuu que horas las que pasamos ayer, llego mas relajada a mi ksa y todo por una buen sexo con mi amigote....y claro siempre es bueno conocer mas del tema para disfrutar cada ves mas del sexo y no solo verlo como penetración si no como una historia que podamos contar una experiencia que vivimos un buen recuerdo..;)

Para Gaby,
Te pasaste con tu sinceridad, ahora puedo entender lo que compartí en otras oportunidades en este post, acerca de una sesión amatoria con una ex, donde sólo recibí, con alegria por cierto, dos eyaculaciones luego de un buen par de mamadas de parte de ella, me extrañaba que no quisiera mas, respondes con tu comentario esa inquietud.
Te felicito y sé felíz, sigue mamándosela a tu pareja

Sinceramente, las mamadas son ricas siempre y cuando el miembro sea de un tamaño prudente, a veces he tenido parejas que tenían un manicito, sobre todo a uno que recuerdo que usaba su truza del Alianza Lima, cuando lo vi me ilusioné y pensé en un supermiembro, relacionándolo con el equipo grone, pero no!, asi que obligado tenía que hacerle una fellatio sino me ponía a llorar por la pequeñez. Después a quienes la tienen grande no presionen la cabeza de la pareja para hacerla que trague más, pueden ocasionar sofocación y hasta asfixia, sean conscientes, pacientes y no se dejen llevar por la excitación, ya que ambos pueden salir perdiendo. Recuerdo hace años en Wash DC, un chico me fue a buscar para conversar, bajó de su carro y en las gradas del edificio nos pusimos a charlar y a besarnos, así estuvimos 2 horas, porque en el depa estaba miprima con su novio, luego me dijo para ir a bailar, asi que entramos al carro y ahí sí que no me aguanté, le di una mamada, francamente estaba tan desesperada por sentir algo más que sus labios y su lengua, el se volvió loco y no quería salir del carro, así seguimos y seguimos, bueno, que más puedo decir, llegamos a bailar cuando casi todo había terminado y la gente ya se iba a sus casas pero ambos teníamos una sonrisota en nuestras caras, que cualquiera pensaría que nos habíamos sacado la lotto. besos.

ES BUENO PERO HAS PROBADO HACER EL SEXO ORAL CON CERVEZA EN AL BOCA ES MUY EXITANTE Y RICO..PAR CAMBIAR LA RUTINA .. OJO AMIGAS CON CERVEZA HELADITA

estaba perdiendo las esperanzas pero ...ups agradable sorpresa ...Su Relato Madame Curie...magnífco.

Hasta ahora recuerdo la primera mamada que me hicieron, estabamos en San Bartolo con mi amiga cariñosa, en medio de unos besos apasionados, mi amiga deslizo sus manos hacia mi pantalon y empezo a sacar mi pene, me palteo al principio por q pense q alguien nos pudiera estar viendo, pero luego con toda la calentura me olvide del asunto. La cosa es q esta amiguita lo chupaba como si fuera un helado q rica sensacion me dio. Lo mejor es que camino de regreso a Lima nos sentamos al final de la couster y me empezo a dar otra mamada, como le gustaba a la condenada.

EXCELENTE Y MUY CIERTO....A DISFRUTAR

muy wen post... a ratos me rei a carcajadas x otros m qd pensando inocentemente, ahi m di cuenta de que aun me falta experiencia y harta calle en fin...
madame curie, wen relato m dejo volando como al pata dl relato...

es hora de q la caperuza ataque al lobo feroz osea a mi :P jejeje

muuuuuuuuuuuuuuuuyyy buen post!!!

a practicarlo!!!

lo ke he escuchado a muchos hombres es que pueden estar durante una mamada alucinante, pero si lo dientes chocan, al carajo toda la faena... como evitar que los benditos dientes choquen??

Esther :Y el tono ???

Buen post, me encantooo el tema que trataste, sobre como estimular a nuestro enamorado, esposo, amante,etcetcetc.
Personalmente tambien se lo chupo pero, me faltaba màs tècnica para hacerlo mejor y con estos tips olvidate lo mato esta nochee.
Gracias por todo.

hola Esther, gracias, gracias, toy feliz, pues resulta q a mi enamorada la convencí y me la chupó, al principio no queria pero sabes, com te contaba la otra vez, es algop mojigata, entonces hice q leyera tu blog, y leia todo los temas q ya habias tratado, y ella ohh, tanto asi!! jajaa, y sabes, eso me ayudó, para q ella se diera cuenta q tenia cosas reprimidas en cuanto al sexo, no la culpo, pues tiene uns viejor muy conservadores mas bein cucufatos, q van a misa y ella desde chiquilla estaba metida en parroquia, ya te imaginas, no era justo q por culpa de sus viejos, ella haya vivido tanto tiempo reprimida sexualmente y francamente yo ya estaba al borde de la locura, mas bien casi saco los pies del plato, pero estoy refeliz, me siento super, pues para ella fue algo asi como un "descubrimiento" sexual de muchas cosas ricas q se pueden hacer durante una relacion, ella me permiti{o hacer realidad tantas fantasias reprmidas, y gozamos rico, nos sentimos maravillados jaja uno del otro, gracias una vez mas por tu blog, pero sabes, seria chévere, si trataras en tu blog algo sobre los reprimidos sexuales, es decir las causas, conseccuencias, etc...

La primera vez que hice un fellatio fue con mi esposo,en aquel tiempo era mi enamorado...No me gusto por que vomite y me atore por tragarme esa cosa tan grande dentro de mi boca....Asi que poco a poco mi esposo me enseño como hacerlo hasta quue aprendi,y segun mi esposo dice q aprendi muy bien por que le encanta cuando lo hago,y ami tambien me gusta mas cuando sale todo su semen calientito dentro de mi boca y chorreando todo mis pechos......Otra q me paso fue cuando tenia tres terapias con el doctor por un dolor de espaldas,cuando me estaba examinando senti algo duro detras mio,era su pene que estaba bien parado pero se hizo el loco y yo tambien.....La segunda terapia ya no se aguanto se bajo en cierre y yo al ver tremenda delicia no aguante lo unico que hice fue arrodillarme y chuparle todo ese pene grande y gruso,igual paso la tercera terapia....Ya termino mis terapias pero el me sigue llamando por que le gusto y segun dice nadies le habia chupado asi.....

Esther,

Ya me tiene hinchado este tema del fellagio, pellagio, lo que sea; pero ya cambialo queremos instrucciones para un buen CUNILINGUIS!!

Hoy se lo hice a mi pareja pero no llego!, necesito el manual de operaciones de esa parte, jeje.

CUNILINGUIS NOW !!!

Un beso de todos los colores

PitufoGruñon

nuevo post please

que tal relato marie curie..
estas perdiendo plata...como escritora obviamente...
de solo leerlo me puse listo para una buena mamada...
chicas...
diviertanse con el pene...pero no se olviden de los dos amigos que estan abajo y de la zona entre ellos y el ano...
una buena estimulacion ahi es lo maximo...
y puede dejar a un hombre en condiciones de rendir al maximo...
se los digo por experiencia...

ayer espere todo el dia un nuevo post

esos "secretitos" me sirven de mucho ya que mi novio es de raza negra y por ende tiene el pene grande, voy a ponerlos en practica dentro de veinte minutos y de pues les comemto que tal me fue

Malu dejame tu correo

Excelente recomendación; una pareja que tuve, además de todo eso, jugaba alternado sorbos de agua con hielo y té caliente para variar la temperatura de la boca.
La primera vez fue durante una fiesta de fin de año, como había estado tomando unas cervezas decidí irme a las 2:00 am al auto a dormir un rato, cosa que a las 6-7 estaría en mejores condisiones para manejar. En eso llegó mi enamorada, me dijo que no deseaba seguir bailando si yo no estaba y que también había tomado un poco de más. Hablamos de cosas sexuales (hasta ese momento con casi medio año juntos había estado bien reticente a que le palmeara el trasero o acariciara el busto), me preguntó si tanto la deseaba, yo era su primer enamorado y era exalumna de un colegio de monjas. Yo le dije que sí y que a las pruebas me remitía, saqué mi pene erecto y la invité a tocarlo para confirmar su dureza como prueba de mi exitación. No tuve que decir nada más, ella se avalanzó sobre él y empezó a chuparlo hasta hacerme eyacular, tragó todo el semén y siguió chupando. Luego yo le practiqué cunilinguis; durante el resto del verano hicimos del 69 nuestra posición de encuentro sexual, aprendiendo y experimentando diferentes trucos.

A mí me gusta hacerle fellatios a mi enamorado. Lo que no me gusta, es que me cuesta demasiado el tragarlo todo (a pesar de acomodarme para ver si entraba más) y otra cosa que me incomoda mucho, es que luego me queda doliendo el cuello, es más, a veces tengo que parar con la boca y seguir con las manos por que el cuello no me da pero leyedo está guía, me ha dado mejores técnicas y mañana veré que tal aguanto. Es entretenido y más aún si hay amor, creo que otras mujeres no lo ven con tanto agrado más por una cuestión cultural, pero no tiene nada de malo, total, yo le hago orales así como me encanta que él me los haga. Algo que sí me resulta gracioso en cierta forma pero me da pena, e sque a veces mis dientes se ponen en el camino, pero nada serio. Con cerveza me lo hizo él, ahora que lo pienso, yo no se lo he hecho con cerveza, será para intentarlo la prox.

Me animo por primera vez a hacer un comentario.

Confieso que hasta ahora no sabia nada de esto, es decir que no sabia la forma de hacerlo.

Pero tengo una curiosidad a mi anterior enamorado le hacia el sexo oral, pero siempre fui conciente de que yo no era una experta, no lo sabia del todo.
Sin embargo, Al finalizar El siempre me daba un beso
Como debo interpretar ello?. realmente le gusto o porque lo hizo. Ha pasado el tiempo lo recuerdo y en ocasiones imagino nuestros encuentros y lo que mas recuerdo es su ternura. ese beso.
Muy buen post Ether, siempre leo y comparto con mis amigas


oh!!!! donde puedo conseguir una chica que me lo haga asi???

ola esther....
te escribia para pedirte un consejo XD! palta me da decirlo pork lo ban a leer toda la people k entran a tu post ....perdona la Palabra...pero es AnaL tu PosT....
te decia k mi flaca no le gusta hacerme un fellats le da asco....y no le gusta....como hago pa convenserla...he probado todo lo k se...pero podrias darme una manito conmi problemita plzz....espero tu rspta ok :)
kiss

Muy buen manual de chupada, dejame decirte que el mayor problema que eh encontrado es que en pleno sexo oral toda la exitación se me baja cuando ellas me hacian doler o incomodar con sus dientes...

Q buenos consejos espero q cuando sea mi primera lo haga bien.
Pero me arias un gran fa?or si me darias consejos para besar. bye

Yo quiero el libro....

estan muy buenos los consejos prometo practicar lo mas seguido posible ..... con eso ya dan ganas la proxima vez prometo ponerlos en practica claro si la persona k tiene en mente me deja

y es exactamente como yo lo hagoo

haber mi amor,,,lee con tu tips para que me lo hagas despacito com me gusta

Quisiera hacer un par de preguntas acerca de este tema...

Primeramente soy en la actualidad lo que se llama gay activo (tal vez cambie con el paso del tiempo, aunque ahora me siento comodo), en los casos que se me presentan para lamer el cuerpo descubri que puedo usar aceites para masajear y asi sustituir mi lengua tan pero tan seca... pero, ¿en el caso del sexo oral que clase de "lubricante" (el cual se refiere en el articulo) deberia usar?

La otra pregunta es: Bueno en el caso de lamer las tetillas de mi acompañante se me ha ocurrido "tocar", sin morder la tetilla, cosa que ha exitado en mas de una ocasion a mi acompañante... en el caso del pene puede causar alguna reaccion no deseada? podria exitar?

Bueno a decir verad es cierto que son pocas las mujeres que tienen el desenfado para poder brindar sexo oral pero para recibirlo ahi si que no ponen mucha resistencia, con respecto a la tecnica es buena seria bueno tambien que escribas sobre el sexo oral que se le brinda a la mujer para que nosostros tambien sepamos complacerlas y a la vez tambien saber que tanto las complacemos con lo que ya realizamos.

Mi novia es una animal haciendo orales.. Por mas que le explique que no use dientes, la mujer sigue y sigue. Ademas es una floja, todo el sexo oral lo hace hechada a mi costado y solo se inclina.

Una ex novia en mi casa me hizo un sexo oral inolvidable, hasta me permitio eyacular en su boca. Fue muy gratificante!.


Y yo creia que era tan simple...

vaya, mis respetos a las mujeres si se atreven a hacer completamente el Manual


20 puntos =)

mi secre me esta haciendo un fellatio
mientras escribo esto...

jaa jaa parece que quiere que le preste atencion!

hola esther buen punto...lo aplicare a mi grone travieso......

mi esposa y yo tenemos 21 años que nos conocemos intimamente y 18 de casados...
como ella es muy tradicional
me ha hecho orales como 10 veces en ese tiempo...solo en momentos u ocaciones muy especiales...
sin embargo no me puedo quejar, cuando hacemos poses es lo maximo, amen de excelente ama de casa, esposa y madre...
no se puede tener todo en esta vida...
buen blog...

Pues los envidio mi Novia simplemente no le gusta Y No me lo hace nunca, vivo un poco frustrado con esa situacion.

humm ya kiero volver a acerlo amorcito cual es tu cel me exitaste demasiado

Hola el tema es interesante la verdad es que cuando era soltero no habia enamorada que no me lo hiciera era excitante, hasta que me case y bueno ahi acabo todo me toco una mujer que la verdad nada con el sexo es buena para hacer plata pero nada que ver con el sexo, nada es perfecto.

AVIS DE RECHERCHE

algun consejo para un casado a la que su mujer nunca ha hecho unas de esas guarradas!!! si hay una flaquita disponible le pago el billete hasta Francia!! espero una respuesta de alguna nina linda y calentona!!
Merci

Esther, ahora haz un curso practico para hombres, xq d verdad, la mayoria d ellos tambien dejar mucho q desear en el sexo oral...algunos no saben ni ubicar el clitoris o resultan muy toscos...y gracias x este articulo, ya podre mejorar la tecnica...un beso

Yo recuerdo una noviecita mia que una vez a mitad de la noche toco lap uerta dem icasa y me dijo :
"Solo he venido para chupartela "
me puso contra la pared, me bajo el pantalon y lo hizo con ganas....me enamore, me tomo meses dejar de pensar en ella luego que dejamos de vernos.
Hasta hoy, mas de 10 anhos despues la recuerdo.
Y le agradezco desde el fondo de mis genitales.

No hay duda que una buena "mamada" deja a los hombres extasiados y maravillados con tu labor. Una cosa importante también es apretar el miembro como si fuera una barra, claro sin hacer daño y hacer movimientos circulares llevándolo lentamente a la boca.Eso los aloca y junto al toque de mariposa, no esta de mas lamer solo el glande y hacer que tu partner te mueva la cabeza de adentro hacia afuera para que tenga un orgasmo mas placentero.Felizmente mis dos ex me han dicho que soy muy buena en esas lides, pero me llevo tiempo perfecionar las técnicas..

¿que no hay filtro en los comentarios?, hombres se hacen pasar como mujeres (uno de los tantos ejemplos: la chata), hombres que les gustaria lo que ven en una peli porno(diavolo, karma y un montononon de etc), pero casos serios no veo ni uno solo, mejor que todos esos enfermitos que piensan que una felación es lo único en el mundo llamen al doctor maestre , en vez de escudarse en un foro y saciar sus bajos instintos, ¿que no basta el mirc donde ofrecen dinero a cuanta chica chatean?

PRUEBEN HACER EL SEXO ORAL CON UN CARAMELITO HALLS EN LA BOCA UFFFFFFFFFFFFF ES LO MAXIMO

Lidia mejor dame tu celular y yo te llamo para hacerlo mas rico como tu quiere y yo tambien o sino habizame como podemos comunicarnos bye espero tu respuesta

Las mamaditas o como las quieran llamar son lo máximo, sobre todo cuando son improvisadas, una de las mejores hasta hoy fue una de esas insatisfechas por su esposo que me hizo delirar...ufff con sólo recordar esa noche donde hubo de todo¡¡¡ saludos Esther, muy bueno tu blog.

El mejor fellatio para mi debe de incluir los testículos y el ano. No hay nada más rico que te laman bien los testiculos (camino hacia el ano) mientras te masturban con la mano.

Otra cosa que es bien provocativa es cuando te mira a los ojos cuando la van chupando y sonreir cuando se la sacan de la boca para respirar un poco antes de continuar.

Yo quisiera hacer un trío y probar que se siente tener 2 mujeres peleándose mi pene para poder deleitarse con mi eyaculación.

De solo pensarlo creo que va goteando ;)

------------------------
Esther... aprovecho para felicitarte por este blog y los temas que tocas. Es importante tener un espacio como este para intercambiar ideas respecto al sexo abiertamente. Hay que tener en cuenta que en la actualidad no vas donde tus amigos y amigas a preguntar que es tener sexo, que es un fellatio o que es un cunnilingus, etc.? Ahora todo lo lees por internet ;)

huy esther eres toda una maestra seguire tus instrucciones esta sera mi primera experiencia jejejejje

La primera vez que le hice sexo oral a un hombre fue en el baño de una discoteka estaba medio pikado, desde esa vez lo e echo un par de veces, ,la ultima vez que lo hice el pata me dijo q le gustaba como se la mamaba y que lo hacia muy bn...hasta ahorita, se podria decir,q es el mejor piropo que e recibido xD

SOY TU HINCHA ESTHER, TU BLOG ES LO MAXIMO.Y SOBBRE EL TEMA MUY BUENO OJALA K MUCHAS CHICAS LO LEAN Y LO PRACTICEN PUES JAJA,YA K ES MUY EXITANTE Y RELAJADOR QUE TE LO MAMEN SOBRE TODO ACARISIANDOTE LOS TESTICULOS Y POR EL ANO, UFFF. DONDE ESTARAS AHORA MI AMOR QUE BIEN LO HACIAS..

Veo que cualgas comentarios en los que incluso te invitan a tener relaciones, otros por los que pdes moderación y decoro. No entiendo porqué no publicaste el mío en el que decía respetuosamente que tu forma de ver la sexualidad, por más progre que pueda ser para mucho por sencillaente hablar de sexo, sigue siendo clásica. Fue un comentario de mucho menos líneas que este donde te recomendaba leer a Beatriz Preciado. Me llama la atención que no lo publicaras.
Saludos,
Elsie

Solo se censuran los comentarios en los que se insulta o se ofende al autor y a los comentaristas. También no aprobamos comentarios que alientan la pedofilia, el racismo o la homofobia.
Qué extraño lo que dices sobre tu coment. En todo caso, buscaré a Beatriz Preciado.

me gusto mucho los datos para hacer un buen sexo oral, hasta el momento a los que le he hecho sexo oral me han ovacionado por los movimientos de mi boca,lengua y manos,pero sin duda lo que escribiste me serviran para que ya no me ovacionen sino para que me idolatren, jeje, gracias por los datos cuidate./

Hola ...me encanto tu blog....lei todos los temas en un dia , este en especial me intereso muchisimo...soy separada hace dos años, en 10 años de matrimonio no le hice ni un fellatio a mi esposo aunque me lo pidio mucho, yo contestaba " primero muerta que mamando" jajaja..pero luego conoci a un chico que actualmente es mi novio,a este lindo sin pedirme ..le hice de todo....definitivamente el amor todo lo puede ..he hecho cosas que jure nunca haria y segun èl para ser nueva en el tema lo hago muy bien ...me dice que le encanta y aun `por telefono me pide que le describa lo que le hago ...eso me encanta por que se y estoy segura que le gusta como lo hago ..y el manual esta aun mejor ..muchos truquitos para anexar en las faenas que hacemos cuando estamos juntos.....lo amo para mi esa es la razon por la cual me decidi a hacerlo....

jojojoj....como me gusta todo esto...es la mejor experiencai de mi vida jajajajaja

Definitivamente una buena mamada es cuando lo tienen toda en la boca y lo meten y sacan sin parar y terminar tomandose toda la leche,es divino es lo q me hacia mi ex toda una mujer bien vivida y con mucha experiencia nunca la olvidare.

... me he topado con cada chica, no se porque la idea de una mamada es tan asquerosa pero bien que cuando las sopeaba lo unico que ellas atinaban ha decir o mejor dicho gemir y gritar... pero a la hora de que le toque recibir lo suyo a este pechito, ustedes comprederan... "me da asco" "No se como hacerlo", etc excusas hasta por demas... lamentablemente no he tenido muchas buenas experiencias en esto pero nunca pierdo las esperanzas de seguir aprendiendo y enseñar un poco XD


Hola:

Pues es un manual casi perfecto, solo lo que nos falta es practicarlo.

Muchas gracias por lo excelentes consejos

Saludos desde México lindo y querido...

Janis

No me agrada chuparla, me llama la atencion los comentarios de las mujeres, pense q a la mayoria no le gustaba, y simplemente no entiendo como se lo pueden tragar, me da nauseas!!! Ademas cuando se la chupo me dan arcadas y solo lo hago para satisfacerlo. Me pidio que lea este blog, pero al parecer tiene que gustarte y bueno ... se decepcionara mi amor ...pero no la hago.
Encima a veces hay hombre bestias que te empujan la cabeza iuuuuuuuuuuuu!!!!

Uyy, ke rico!! me encanta hacérselo a mi chico y creo que no lo hago mal y como por ahí dicen, mientras más practicas, mejor sale. Uyy, ya me dio ganasss, creo que llamaré al amigo cariñoso :P

holaaa huii!!!! oie! estubo wenisimo y pa las interesadas y con ganas ia saben que hacer(recurrir a mi porsupuesto :D)

Interesante los consejos que brinda este post, si lo hubiera leido antes de que me hicieran el primer fellatio de mi vida creo que la experiencia hubiera sido diferente.

hola es la primera vez que escribo en tu blog realmente me parece interesante,en mi caso hasta ahora no eh hecho un fellatio no se no puedo me da arcadas mi enamorado siempre me lo pide pero no puedo el me quiere hacer sexo oral pero no lo dejo por bueno si el me lo hace de alguna manera yo tendria que hacerle a el tambien, pero no puedo me da arcadas terribles.

Opino que todo esta bien rico,

bueno si lo he practicado pero a mi experiencia seria muy bueno si quien te lo hace es tu chica como que ahi confianza mas con ella que con una llamada amiga cariñosa o una amiga express

Sos una GENIA!!!!!!!
Bueno consejos para practicar...
Un dato: el hacelo con marroc... una delicia para la mujer y par el hombre ni te cuento... ;) Saludos

una pregunta esther :


que hacen los travestis para chuparla tambien , es super rico .


Te lo pregunto porque mi enamorada actual lo hace horrible.

es algo natural o genetico

excelente a mi me lo hizo mi flaca, quien previamente me comento que había leído estas pautas, lo que paso fue fenomenal muy bien adisetrada y se tomo toda la leche.........

uhhhhhhhhhh como extraño a mi pareja, era excelente, lo importante que ambos gozamos del sexo, ella parecia que chupaba su heladito de fresa y chokolate y lo saboreaba y a mi me encantaba hacerle la "sopita" y ver como se mojaba de placer.
Esto es delicioso pero es para parejas que procuran superar los posibles tabues, de lo contrario mejor es no hacerlo, porq seria una mala experiencia........pero en definitiva es bueno arriesgarse.

el sexo es lo mejor!!!!al menos el fellatio!1uufffffffq rico..


a mi siempre me funciona bien si es que
primero atiendo a mi mujer. me he dado cuenta
que ella lo chupa con mas ganas si es que
tu la complaces primero. Preferentemente
si la haces venir primero...

Creo q es cierto eso de primero las dams

Hola Esther.. Antes q todo debo empezar por admitir que leo tu blog desde hace hace algun tiempo, pero si te soy sincera tenía algo de "roche", comentar en una página que exclusivamente habla de sexo.
Y es que yo a mis 22 años era del tipo de chica al que sólo le gustaba la típica pose, y bueno de vez en cuando un pokito de morbo que iba en aumento. pero nunca hasta llegar al fellatio...
Desde que empecé a leer tus blog, aumentó mi curiosidad y en cierta ocasión, mi enamorado me pidió ´"por qué no me la chupas" me dijo, con cierta duda, creyendo que no me atrevería... (no lo hice) y mi respuesta negativa (excusada por el roche), lo dejó un poko frustrado.
Lo pensé en silencio por una semana y me dije a mi misma, ¿por qué? no... si yo lo adoro...
Además el me besaba con pasió ahí abajo. así que lo consideré justo. algo así como DAME QUE TE DOY...
En fin... Ya han pasado algunos meses, desde que voy progresando... en esta faceta. Hace unos días me comentó que se sintió como si fuera su primera vez,Nervioso, avergonzado, por que tuve la osadía de mirarlo a los ojos con cierto morbo, y lujuria que no podia disimular...
lo disfrutó tanto, que por momentos estaba ahí. Literalmente es como si tocara el cielo con la yema de los dedos. (eso fue lo que me confesó)--
Lo bueno es que a mi tmb me agrada, lo disfrutamos los dos.
Y está demás decir que dejé en el pasado mi temor por descubrir nuevas formas de hacer el amor....!!!

Lo unico dificil es superar el roche...!!! Por lo demás creo que todo es innato.... Yo no sabía como hacerlo para nada.... Y ahora me siento como diría Esther misma Star Porno (claro en ese instante)...

le pongo 17 a melosita

Wauuu q buenos datos...ayer estuve con mi ex y lo hicimos en la oficina d nuestro trabajo...se noto completamente como lo disfruto y me dijo q fue de lo mejor y hasta nota puso...20!! jaja XD


Muy interesante siempre todos tus consejos

mmmmmmm!! ¿Será que mi mujer ya no me ama?, recuerdo que se esperaba pero nada, era muy torpe al mamármela... ¿cuándo mejoro?, cuando le di unas notitas o tips, y zas!!! lo máximo... la mama de maravilla... a alguien lo hicieron eyacular en 3 minutos, pues mi Lilian lo logro... 3 minutos, que súper mamada!!!.

Nadia, wauuu!!! Tú me la mamabas de maravilla, algunas veces te extraño, ¿será por que mi Lilian ya no me ama? , ahora dice que está muy cansada, que no tiene ganas, que debe levantarse temprano... dormimos, y a las 3 am, llora nuestra hija, ¿será que mi mujer ya no me ama?

lo tendre muy en cuenta que rico

kieres aprender a mamar?, mira una porno ps!!, mas facil no hay

me encanta este post soy una total inexperta haciendos exo oral solo lo he hecho un par de veces pero con lo que escribiste creo que aprendi un poco mas... gracias... seguro a mi chico le encantar cuando se lo haga bye...

Mi ex decía que le encantaba y siempre era rigor comenzar con eso, ya que lo necesitaba para tener una buena erección. MI actual pareja no lo requiere ya que cuando llega a mi boca ya esta bastante dura, sin embargo también es requisito obligado para comenzar, digo a mi en lo personal no me disgusta y me agrada que le guste tanto, pero me preocupa que sea algo rutinario, ya que es comienzo obligado y cuando me dice que tiene ganas de sexo, me dice que tiene ganas de una mamada. Siento como si le gustara más eso que la penetración. Será algo para preocuparse?

A mi me gusta hacerlo en lugares dificiles o de peligro, una azotea, un baño de officina, recuerdo que una vez trabajaba en un edificio de una empresa electrica y habia una chica que me buscaba, hasta que nos encerramos en una oficina (trabajabamos de madrugada) y empezamos a tener sexo, yo estaba intimidado al comienzo y ella para hacerme entrar en calor se acerco y de frente bajo hasta mi muñecon y le dio una mamada espectacular.. se lo comia con unas ansias, estaba de rodillas y luego de eso la hice mia contra la pared y el gusto de ella.
salimos de la oficina y su amiga la estaba buscando en el piso anterior para avisar que su esposo estaba abajo esperandola en la puerta con su auto.

Increible no era la intencion pero se dio, nos volvimos a ver pero ya no paso nada por que me senti algo mal. pero creo que si la volviera a ver intentaria repetirlo.

Otra vez fue con mi ex-enamorada en una clinica por la av. javier prado, la visite y estaba con un escote riquisimo... fuimos al baño del consultorio y me hizo un sexo oral riquisimo ella de rodillas pendientes de que pudiera venir el doctor... hace muchos años paso eso, quisiera saber donde esta....

La ultima vez fue en una empresa de motos, fui a la oficina de una amiga y pusimos la camara web estaba por suerte un amigo en linea y lo contactamos y ella empezo a darme sexo oral, no se imagina cuanto disfrute... y mi amigo tambien viendonos... quedo en anecdota...
igual la extraño a mi amiga de travesuras...

Uds. alguna chica o pareja se animan ¡¿
saludos

AHET
augusto_e@hotmail.com

Excelente articulo!!!! mi esposo se lo agradecera!!!!! aprender nunca sobra!!! jajajajajajajajajajaj

Buenisimo eso si exita... aunke ya se como hacer no esta nada mal algunas recomendaciones.

Una experiencia ultima de este tipo fue en un colegio por la av. venezuela, fui a realizar un servicio de soporte y mi pareja trabajaba en una oficina, como era tarde nos quedamos solos y nos metimos al baño que no era del todo cerrado (tipo colegio) e hicimos el amor y ella me hizo sexo oral, al inicio no queria por el temor de que viniera el vigilante, pero tanto que insiste y afloja al final lo hicimos y eso fue excelente por que me vine y lo recibio todo y lo mejor fue que al final nos reimos de la aventura, como siempre al final ya no nos vemos mucho.

Pero creo que la adrenalina de hacerlo en momentos y/o situaciones no planeadas da mayor libido.

Saludos

bueno ami me han mamado muchas mujeres pero
siempre hay una q marca la diferencia..........................
es mi amante debs en cuando salimos por q la
llamo lo hace y me lo mama con una pasion que cualquier hombre
quisiera q lo aga aveces me afeitaba toda mi parte
dond esta mi pene y mis huevos solo para ella
le exitaba + pasa el tiem'po y no la voy olvidar aunq vive muy lejos
.....................................tengo mi jerma tambien me lo mama
pero no como ella..............................

siempre la recuerdo como la mejor...........
cuidate estela ya nos veremos

me afeitare para ti

¡Uhmmmmm!! La verdad, será que me gusta mucho mi hombre pero en verdad gozo mucho chupándosela de lo lindo. Muchas veces tengo orgasmos mientras lo hago y mojo la cama un montón.Seré algo masoca, pero me encanta que me fuerze un poco a ello. Y a todo lo que se le ocurra también. Me excita muchísimo que él sea el que lleve la batuta, soy tímida pero dócil y adoro chupársela. ¡Que rico!!

sencillamente un post espectacular.la felacion es una delas faenas sexuales que mas me encanta que me hagan, pero de manera completa, acariciando, jugando con el pene, usandolo como si fuera un lapiz labial, masturbandolo despacio y tambien fuerte, cambiandole de ritmo, acariciarlo por el rostro de la femina (mejor aun si es un rostro inocenton pero a la vez excitado) y que se metan toda tu verga dentro de la boca, wuau, creo yo, personalmente, que no hay nada mas excitante que una garganta profunda (gracias al cielo, dios no, no lo metamos al viejo en esto que es medio cucufato, he tenido la suerte de vivirlo una vez con una ex novia, quien lo logro de a pocos y en varias lides.ahora dichoso el que lo tenga con ella, disfrutara los frutos de mi arduo trabajo,jeje. y otra experiencia fue con una chica conocida de mi epoca de colegial, una chica tranquila, al menos en ese tiempo, la cual siempre me mostro interes. salimos hace un mes, y a la tercera cita ¡eureka! pero que chiquita en la cama era, no era una garganta profunda, pero su manera de chuparmela era como un perdido en el desierto que se topa con agua, y heladita, aunque lo que termino bebiendo salio muy caliente. y ahora le digo, cambiando letras de un tema de arjona "si el pasado te enseño a mamar asi, benditos los falos que estuvieron antes de mi"

Saludos Esther Vargas y mil besos para ti. Y ahí está el dilema "Sex o no sex" que Shakespeare ni que nada. jeje.

PDTA: Yo digo que hagamos un pedido de que le suban el sueldo a Esther por su muy buena y, más util aún, columna.

ES PELIGROSO QUE LA MUJER SE TOME EL SEMEN CUANDO LA TERMINA DE CHUPAR?

LE HACE BIEN A SU ORGANISMO?
LE HACE MAL A SU ESTOMAGO??

Esther por favor contestame las interrogantes anteriores, me inquieta muccho el tema, gracias??

Buenos respecto al tema deseo opinar que hay una regla general en esto del sexo, todo lo que parece prohibido allí está lo rico del asunto.

Sólo hay que dejarse llevar por este instinto y la cosa sale fenomenal.

Esta recomendación es tanto para los hombres como para las mujeres, no esperen chico(a)s que nos hagan todo en la cama, la creatividad es de dos , y el placer que se puedan prodigar ambos en distintas formas es bueno, claro que para eso hay que tener confianza y bastante dialogo.

Si nos vamos a la cama esporadicamente con una y otra pareja, esto para mi es un desastre porque no sabría en que notas u ondas está mi pareja de turno y que roche preguntarle en one, lo podría tomar como un interrogatorio .

YA SE ME PARO! jajajajajajajajaja!!!

Una pregunta, leí que hay muchas bacterias en la boca, eso produciria alguna enfermedad al pene?? =S

Hola Ester
es un lindo tema el que has tratado, sabes soy casado, 13 años de matri y a mi esposa ni se le ocurre cogerlos, peor aun darle una carica, y el oral dice que es algo asqueroso. que lamentable situacion

Hace cuatro meses saque los pies del plato, fue algo que no lo busque pero las casas se presentaron, es una nena de 26 años, le llevo por 16, no sabes como le encanta el sexo oral, ella tiene orgasmos cuando se encamota con mis dos huerfanos, le encanta el semen, que me venga en su boca o en sus pechos, eso me ha hecho gozar del sexo como no sabes cuanto, ella aprende mucho de mi como yo de ella, nos comprendemos plenamente, lamentablemente tengo que volver a mi realizad cada vez que retornamos a nuestros hogares, com no haberla conocido antes, ella deja en alto a las chicas amantes del sexo ...

Escribir un comentario


Introduzca los caracteres que ve en la imagen de arriba.